Mathematics, 03.03.2022 02:50 emmafrye1

What is the area of this trapezoid? Enter your answer in the box.

units2

A rectangle with a length of 3 and a height of 8 has two right triangles on each side of it with short leg lengths of 7.

What is the area of this trapezoid?

Enter your answer in the box.
units2
A rectangle with a lengt

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 20:50

Including 6% sales tax, an inn charges $135.68 per night. find the inns nightly cost

Answers: 1

Answer

Mathematics, 21.06.2019 23:00

Asporting good store is offering 30 percent off of the original price(x) of football cleats. the discount will be reduced by an another $7 before sales tax.

Answers: 1

Answer

Mathematics, 21.06.2019 23:00

Divide. –4.2 ÷ 6 = a –0.7 b 0.7 c –7 d 7 me

Answers: 2

Answer

Mathematics, 22.06.2019 02:40

Ineed the answers for this one as well!

Answers: 1

Answer

You know the right answer?

What is the area of this trapezoid? Enter your answer in the box.

units2

A...

Questions

Mathematics, 06.12.2021 09:50

460,451,442,... Find the 37th term. Find the 37th term....

Biology, 06.12.2021 09:50

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5' Type of mutation (3pts): Amino acid ( 3pts...

Biology, 06.12.2021 09:50

What is the building unit that enters the plant cell organelle membranes? A -fatty acids b -ribose sugar c -simple lipids d -nucle...

Mathematics, 06.12.2021 09:50

Suppose that the number of cars manufactured at an automobile plant varies jointly as the number of workers and the time they work. If 220 workers can...

Biology, 06.12.2021 09:50

If you were given a cylindrical structure cut from part of a plant, how could you tell whether it was a piece of stem or a piece of root:...

English, 06.12.2021 09:50

Pre-Reading White Man's Burden 1b. Why was White Man's Burden written? 1c. Why might the White Man's Burden be an important historical d...

Biology, 06.12.2021 09:50

Any girl little stressed out of assignment after long day wanna have little fun before going to bed? So if you down?...

English, 06.12.2021 09:50

Just getting boredtell me a joke anyone herefrm following...

English, 06.12.2021 09:50

Select the closing paragraph that is more effective, satisfying readers and summarizing the main idea, 5 As we have seen, there is a gre...

Arts, 06.12.2021 09:50

Bret had always hoped to live on the seashore? What is the phrase? What type of phrase?...

English, 06.12.2021 09:50

Anyone is on-line Here??Getting s bored...

Biology, 06.12.2021 09:50

Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts):

History, 06.12.2021 09:50

GOOD AFTERNOON ALL. . ....

Mathematics, 06.12.2021 09:50

The world’s two highest dams are both in Tajikistan. The Rogun dam is 35 meters taller than the Nurek dam. Together they are 635 meters tall. Find the...

Geography, 06.12.2021 09:50

Describe the Natural topography in Northern region?...

Mathematics, 06.12.2021 09:50

N 70 5.4 4.8 P Using trig to ding angles...

World Languages, 06.12.2021 09:50

Ilang step ang kaliangan pag uuwi kana?...

Biology, 06.12.2021 09:50

Mathematics, 06.12.2021 09:50

460,451,442,... Find the 37th term. Find the 37th term....

Arts, 06.12.2021 09:50

Based on the evidence, the officer was ready to make an arrest. What is the phrase? What type of phrase is it?...

More questions: Mathematics Another questions

What is the area of this trapezoid? Enter your answer in the box. units2 A rectangle with a length of 3 and a height of 8 has two right triangles on each side of it with short leg lengths of 7.

Answers

Another question on Mathematics

What is the area of this trapezoid? Enter your answer in the box.

units2

A rectangle with a length of 3 and a height of 8 has two right triangles on each side of it with short leg lengths of 7.