3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

Interpret the model. a three-part model with black right-arrows between the parts. left part: a large green apple-shaped component with a w-shaped indentation centered on top. a small blue apple-slice shape sits above the left indentation and an arrow points from the shape to the indentation. a small purple apple-slice shape and arrow sit above the right indentation and an arrow points from the shape to the indentation. middle part: a large green apple-shaped component with a square indentation centered on top. sitting in the left side of the indentation is a blue apple-slice shape with a flat bottom, fused to a purple apple-slice shape with a flat bottom on the right side of the indentation. right part: a large green apple-shaped component with a w-shaped indentation centered on top. an up-arrow is centered above the indentation pointing to a fused blue and purple apple-slice-shaped flat-bottom component sitting above the indentation. assigne "true" or "false" to the end of each statement. the model shows a shape change occurring in the enzyme after the substrate is bound in the active site. t/fthere are two products in this model. t? f there are three substrates in this model. t/f the model shows two different enzymes. t/f

What are the responsibilities of the region of the brain highlighted below? =+= will rate brainiest =+=

The normal shape of an enzyme is as shown in structure a. if the enzyme’s shape changes to that shown in structure b, what are two consequences of this change?