3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type...
![subject](/tpl/images/cats/biologiya.png)
Biology, 06.12.2021 09:50 ayoismeisjjjjuan
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation (3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation ( 3pts) :
Amino acid ( 3pts):
Type of mutation ( 3pts):
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:30
Interpret the model. a three-part model with black right-arrows between the parts. left part: a large green apple-shaped component with a w-shaped indentation centered on top. a small blue apple-slice shape sits above the left indentation and an arrow points from the shape to the indentation. a small purple apple-slice shape and arrow sit above the right indentation and an arrow points from the shape to the indentation. middle part: a large green apple-shaped component with a square indentation centered on top. sitting in the left side of the indentation is a blue apple-slice shape with a flat bottom, fused to a purple apple-slice shape with a flat bottom on the right side of the indentation. right part: a large green apple-shaped component with a w-shaped indentation centered on top. an up-arrow is centered above the indentation pointing to a fused blue and purple apple-slice-shaped flat-bottom component sitting above the indentation. assigne "true" or "false" to the end of each statement. the model shows a shape change occurring in the enzyme after the substrate is bound in the active site. t/fthere are two products in this model. t? f there are three substrates in this model. t/f the model shows two different enzymes. t/f
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:40
What are the responsibilities of the region of the brain highlighted below? =+= will rate brainiest =+=
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:10
The normal shape of an enzyme is as shown in structure a. if the enzyme’s shape changes to that shown in structure b, what are two consequences of this change?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00
This is one of the five kingdoms in the older biological succession. organisms in this kingdom are prokaryotic.
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.12.2020 21:50
![question](/tpl/images/cats/mat.png)
Mathematics, 02.12.2020 21:50
![question](/tpl/images/cats/mat.png)
Mathematics, 02.12.2020 21:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.12.2020 21:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 02.12.2020 21:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.12.2020 21:50
![question](/tpl/images/cats/fizika.png)
Physics, 02.12.2020 21:50
![question](/tpl/images/cats/mat.png)
Mathematics, 02.12.2020 21:50
![question](/tpl/images/cats/mat.png)
Mathematics, 02.12.2020 21:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 02.12.2020 21:50
![question](/tpl/images/cats/himiya.png)