Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5'

Type of mutation ( 3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

With the description of the different cell walls, membranes, and associated proteins set in the students' minds, you now need to introduce them to the idea that the cell wall can also act as a foundation to build things upon. bacterial appendages require a strong foundation that will offer the support needed to move and function in a dynamic world. for example, flagella are long, whiplike protein structures that are used by many gram-positive and gram-negative bacteria for locomotion. in order to function effectively, a flagellum must be firmly anchored to the cell wall. how will you be able to get across the idea that the peptidoglycan cell wall is strong enough to support such a mechanism? with a protein rod that passes through the cell wall and protein rings used to anchor it in the membranes, these basal bodies are the rudimentary biological motors that use atp power to spin the hook and the flagella attached to it. bacterial flagella have a biological motor that spins within the cell wall and is powered by atp. this allows the flagella to spin in a whiplike motion to propel the bacterium.

Stephen is a student who wants to test his knowledge of medical terminology. which option could he use?

You want to cultivate some exotic plants at your farm. however, the climate is chillier than the temperature range favorable to the crop. which is the best method to use for the cultivation of this exotic crop? a. use a crop rotation method b. use a lot of fertilizer c. prepare the seed bed properly d. use a greenhouse e. use irrigation