subject

Mathematics, 23.09.2019 15:20 kelseybieberrr19

Swimming pool pete's pools installs rectangular pools that are all 10 feet wide. the length can very from 10 feet to 30 feet. the company installed a pool with a perimeter of 76 feet. what was the length of the pool?

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 23:00

The table below shows the function f. determine the value of f(3) that will lead to an average rate of change of 19 over the interval [3, 5]. a. 32 b. -32 c. 25 d. -25

Answers: 2

question

Mathematics, 22.06.2019 00:30

Two cities a and b are 1400km apart and lie on the same n-s line. the latitude of city a is 23 degrees. what is the latitude of city b. the radius of the earth is approximately 6400km.

Answers: 3

question

Mathematics, 22.06.2019 01:30

What is the equivalent fraction for the following fraction using 5 as the multiplier? 1/2

Answers: 2

question

Mathematics, 22.06.2019 02:00

The first term of a sequence is -12. the recursive formula for the sequence is an = an-1 + 9. what are the next 3 terms in the sequence? a) -3, -15, -27 b) -3, 6, 15 c) -3, -6, -3 d) -3, -6, 3

Answers: 2

You know the right answer?

Swimming pool pete's pools installs rectangular pools that are all 10 feet wide. the length can very...

Questions

question

Computers and Technology, 28.10.2019 21:31

An allocator move allocated blocks to the end of the heap to maximize throughput. select] select should not should 2. an allocator allocate unaligned...

question

Mathematics, 28.10.2019 21:31

The percentage of titanium in an alloy used in aerospace castings is measured in 51 randomly selected parts. the sample standard deviation is s = 0.37...

question

Business, 28.10.2019 21:31

Sold goods costing $1,200 for $2,000 on account. after two weeks the customer returned the goods. there is nothing wrong with the goods; the customer...

question

Business, 28.10.2019 21:31

Two balloons contain the same amounts of water, sugar, and yeast. two other balloons contain the same amount of water, but have no sugar or yeast. the...

question

Spanish, 28.10.2019 21:31

2. javier piensa en abrir una compañía exportadora de café. cierto falso 3. el padre de javier tiene conexiones con contadores en barcelona. ci...

question

Spanish, 28.10.2019 21:31

1- escogermultiple choice activity audio instructionslisten to each question and choose the most logical response. october 18 11: 59 pm 1 attempt rema...

question

Computers and Technology, 28.10.2019 21:31

Python question: write a program that generates a random number in the range of 1 through 100, and asks the user to guess what the number is. if the...

question

Health, 28.10.2019 21:31

Indicate whether each statement is true or false regarding type 1 and type 2 diabetes mellitus. 1. type 1 diabetes mellitus is also called non-...

question

Business, 28.10.2019 21:31

Molly mocha employs one college student every summer in her coffee shop. the student works the five weekdays and is paid on the following monday. (for...

question

Chemistry, 28.10.2019 21:31

Which has the higher enthalpy under these conditions, 2 o3(g) or 3 o2(g)?...

question

Business, 28.10.2019 21:31

Jill lives in a large metropolitan area. she is thinking about starting a senior citizen van service, where she will pick up seniors from nursing home...

question

Mathematics, 28.10.2019 21:31

Give an example of a quadratic equation with 2 + 3i as one of its solutions...

question

Mathematics, 28.10.2019 21:31

Define: voluntary responsea) every possible sample of a given size has the same chance to be selected. b) using extraneous factors to create similar...

question

Chemistry, 28.10.2019 21:31

Which of these equations represent reactions that could be used in constructing an electrochemical cell? check all that apply....

question

Chemistry, 28.10.2019 21:31

By looking at the uncertainty of the bacterium's position, did the student have a valid point? a. the student has a point. the uncertainty of...

question

Biology, 28.10.2019 21:31

Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (sing...

question

Biology, 28.10.2019 21:31

What is the main advantage of a sole proprietorship?...

question

Physics, 28.10.2019 21:31

Development of life goals, access to community resources, long-term counseling, and accountability are all examples of case management....

question

Mathematics, 28.10.2019 21:31

Ababy woolly mammoth that was discovered in 2007 died approximately 39,000 years ago. how many c-14 atoms per 1.0 × 108 c-12 atoms would have be...

question

Mathematics, 28.10.2019 21:31

Use the method in the example to find the square roots of 1 + √3i...

More questions: Mathematics Another questions

Questions on the website: 13722363