Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode...
Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode for this mrna? provide the sequence in form (single-or doublestranded) in which it would predominantly appear in the cell. label the termini.
b. draw the result of translation in atomic detail (i. e. chemical structure).
c. how many different mrna sequences could directly* encode for this same translational product? (* disregard non-coding nucleotides.)
d. how many different single nucleotide mutations could be introduced into the directly encoding dna?
e. how many different translational products would result?
Answers: 1
Biology, 21.06.2019 18:00
Which process is involved in growing crops? irrigation transportation recreation condensation
Answers: 2
Biology, 22.06.2019 03:00
Johnny rode his bike to a friend's house 4 blocks down the street in his neighborhood. he immediately rode back home once he realized his friend was not able to play. what was his displacement for the total bike ride? how did you determine this? what could we use as a reference point to determine he was in motion during his bike ride? why can you use it as a reference point
Answers: 1
Biology, 22.06.2019 07:30
Ture or false evidence for evolution includes millions of fossils
Answers: 1
Biology, 22.06.2019 10:00
Which is an example of a vestigial structure? a. tail of a monkey b. fin of a fish c. flower of a plant d. tailbone of a human
Answers: 2
Mathematics, 04.02.2020 00:00
History, 04.02.2020 00:00
Mathematics, 04.02.2020 00:00
Mathematics, 04.02.2020 00:00
Mathematics, 04.02.2020 00:00
Mathematics, 04.02.2020 00:00
History, 04.02.2020 00:00
Mathematics, 04.02.2020 00:00
Mathematics, 04.02.2020 00:00
Mathematics, 04.02.2020 00:00