Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode for this mrna? provide the sequence in form (single-or doublestranded) in which it would predominantly appear in the cell. label the termini.
b. draw the result of translation in atomic detail (i. e. chemical structure).
c. how many different mrna sequences could directly* encode for this same translational product? (* disregard non-coding nucleotides.)
d. how many different single nucleotide mutations could be introduced into the directly encoding dna?
e. how many different translational products would result?