Spanish, 12.08.2020 09:01 taykola

Read the sentence and choose the option with the correct verb in the future tense. El próximo mes, Fabio sobre el ciclo de la vida en la clase de ciencias. hablará hablaremos hará heremos

Answers: 3

Show answers

Another question on Spanish

Spanish, 23.06.2019 09:20

Cuando en un relato se hacen descripciones físicas y psíquicas de un retrato se llama paisaje como a la de los lugares

Answers: 2

Answer

Spanish, 23.06.2019 22:30

Ser/ir: past tense in this group. both verbs have the conjugation.

Answers: 1

Answer

Spanish, 25.06.2019 01:40

Soy parte del equipo de fútbol americano. para poder lanzar el balón mejor, a. carreras de fondo b. levanto pesas c. pateo la pelota d. tengo agilidad

Answers: 2

Answer

Spanish, 25.06.2019 03:30

Arelay race is 6 miles each runner runs 2/3 mile how many runner must be on each team

Answers: 1

Answer

You know the right answer?

Read the sentence and choose the option with the correct verb in the future tense. El próximo mes, F...

Questions

Business, 14.04.2021 23:40

Suppose you buy a CD for $300 that earns 3% APR and is compounded quarterly. The CD matures in 3 years. Assume that frauds are withdrawn before the CD...

Mathematics, 14.04.2021 23:40

Question number. 2 to 5 ...

Business, 14.04.2021 23:40

Becky spends at least 40 hours a week at her place of business. Becky's initial investment is $40,000. That money can be invested in a corporate bond...

Mathematics, 14.04.2021 23:40

Which describes the correlation shown in the scatterplot?...

Mathematics, 14.04.2021 23:40

How can I find the prime factorization of a number with an easy explanation?...

Mathematics, 14.04.2021 23:40

Mrs. Wu uses a 25% off coupon to buy 1 adult ticket and 1 child ticket to a movie. She pays a total amount of $9.00. A child ticket without the coupon...

Computers and Technology, 14.04.2021 23:40

So, I am working on an example for codehs. It wants me to set my constructor so that it is public, which is what I did, however, an error is still sho...

Biology, 14.04.2021 23:40

The diagram to the right shows a phase of mitosis. Which of the following statements describes what is occurring in this phase? * (1 Point)

Mathematics, 14.04.2021 23:40

A math class has 3 girls and 7 boys in the seventh grade 5 and 5 girls and boys in the eighth grade. The teacher randomly selects a seventh grader and...

Mathematics, 14.04.2021 23:40

QUESTION IS IN PICTURE BELOW!! NO POSTING LINKS OR ANSWERING FOR POINTS

Chemistry, 14.04.2021 23:40

Many campers use propane, C3HS, as a fuel for cooking. If a tank contains 4.54 kg of propane, what volume of propane gas could be supplied at 12°C and...

Mathematics, 14.04.2021 23:40

The table below represents an exponential function, g that has been vertically shifted from the parent function, f(x)=2x

Mathematics, 14.04.2021 23:40

7. Find the measure for angle 2. Justify your answer.

Mathematics, 14.04.2021 23:40

What is the area, in square inches, of the trapezoid below? 15.7 in 8 in 6.6 in...

History, 14.04.2021 23:40

Not long ago, the Federal Merit Systems Protection Board (MSPB) conducted a multi-year study of the federal government’s civil service system and its...

Biology, 14.04.2021 23:40

How does Ebola compare to other potential zoonotic diseases like SARS coronavirus, bird flu, or MERSA?...

Arts, 14.04.2021 23:40

Which light sources does a flatbed scanner use?...

Mathematics, 14.04.2021 23:40

CosB = 13/33 for which of the following triangles?

Chemistry, 14.04.2021 23:40

If an astronaut weighs 79 kilograms (175 pounds) and his space suit weighs 50 kilograms (110 pounds), how much would the astronaut and his suit weigh...

Biology, 14.04.2021 23:40

What is the complementary DNA of TACCGGATGCCAGATCAAATC?...

More questions: Spanish Another questions