What is the complementary DNA of TACCGGATGCCAGATCAAATC?

Marianne is comparing two animals: a fruit fly and a fruit bat. she asks, "do a fruit fly and a fruit bat share a common ancestor in their evolutionary history? " according to evolutionary theory, what is the answer to marianne's question?

In natural selection, what is actually “selected? ” a) alleles are directly selected b) genotypes are directly selected c) phenotypes are directly selected d) entire populations are directly selected

What are simmilarities and differences between anaerobic respiration in animal and yeast cells? would prefer to get simmilarities as i already got some differences. you!