subject

Mathematics, 20.09.2021 14:00 ray1840

-5+4[3(-8+4)-(4-3)]
Please show work :)

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 15:00

What are the relative frequencies to the nearest hundredth of the columns of the two-way table?

Answers: 2

question

Mathematics, 21.06.2019 16:30

Abby is preparing fruit punch for her party. she starts with a bowl filled with liquid that has 1/2 fruit juice and 1/2 sprite, but she decides it's too fruity. so she pours out 1/4 of the liquid, and then fills the bowl up again with sprite. what fraction of the punch is now sprite?

Answers: 1

question

Mathematics, 21.06.2019 19:30

In need of in the diagram, ∠abc is a right angle. ∠dbc = 30°27'40". find the measure of ∠abd.

Answers: 1

question

Mathematics, 21.06.2019 22:30

What number is 7 units left of -15?

Answers: 1

You know the right answer?

-5+4[3(-8+4)-(4-3)]
Please show work :)...

Questions

question

Mathematics, 04.07.2019 12:30

Vicki paid $22.95 for a sweater that usually sells for $27. what percent discount did she receive?...

question

Biology, 04.07.2019 12:30

In which of these illnesses do cells in one part of the body grow abnormally or out of control and possibly spread to other parts of the body?...

question

Spanish, 04.07.2019 12:30

Where is abraham ahora? with mrs. morningstar hiding with william en el cementerio en el zoológico...

question

History, 04.07.2019 12:30

Did the civil war end before or after the assassination of abraham lincoln...

question

Biology, 04.07.2019 12:30

5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand a...

question

Biology, 04.07.2019 12:30

Explain the main difference between organisms of the domains bacteria and archaea and organisms of the domain eukarya....

question

Spanish, 04.07.2019 12:30

El verbo ser y estar i. complete the story, use the correct form of the verb "ser" or "estar" el juan. el de arizona. juan muy triste. juan perdio...

question

Business, 04.07.2019 12:30

Afirm has $100 million in revenues. does that mean it has generated a cash flow of $100 milion?...

question

Mathematics, 04.07.2019 12:30

What are the roots of the equation? 6x^2=18x...

question

Chemistry, 04.07.2019 12:30

Achange that occurs when a substance changes composition by forming one or more new substances...

question

Physics, 04.07.2019 12:30

An object has a constant acceleration of 3.2 m/s^2.at a certain instant its velocity is 10 m/s . what is its velocity after 5 sec...

question

Social Studies, 04.07.2019 12:30

An election held within a political party at which the voters choose candidates who will appear on the ballot in an upcoming general election is a(n)...

question

English, 04.07.2019 12:30

Hunger games movie what work have they generated/produced in the past?...

question

Social Studies, 04.07.2019 12:30

Chandra believes that her astrological sign, libra, provides a guide for her daily and weekly actions. she reads her horoscope every morning without f...

question

Mathematics, 04.07.2019 12:30

What is the slope of y-intercept of this line? y=-6x+2...

question

Business, 04.07.2019 12:30

If the amount payable in two years is $2420 for a simple loan at 10 percent interest, the loan amount is...

question

English, 04.07.2019 12:30

Did you know african elephant is an endangered species? a. an b. _ c. the...

question

Mathematics, 04.07.2019 12:30

K12 3.12 congruence and rigid motions...

question

Mathematics, 04.07.2019 12:30

What is the completely factored form of f(x)=x3−7x2+2x+4? f(x)=(x−1)(x−(3+13−−√−(3−13−−√)) f(x)=(x+1)(x−(3+13−−√−(3−13−−√)) f(x)=(x+1)(x−(3+52−−√−...

question

Mathematics, 04.07.2019 12:30

In august to simmons water bill was $48 in september it was 15% lower what was a simmons water bill in september...

More questions: Mathematics Another questions

Questions on the website: 13722367