5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand above? mrna what would the primary linear structure of the protein be based upon the mrna strand above?due tonight.

Which ocean is on the eastern coast of north and south america? arctic ocean indian ocean pacific ocean atlantic ocean

Producing disposable grocery bags consumes resources. recycling disposable bags is a solution that can recover some of the resources used to make new bags. which of the following behaviors could further refine the solution? a. disposing of bags by burning them b. reusing bags whenever possible c. using bags at once so that they do not break d. using only nonrenewable materials to make new bags subject is environmental science for apex users

What is the most important inorganic material for livings things? ! due tomorrow!