Mathematics, 18.09.2021 22:30 hiiliohi6300

Pls help me I will make you brain

Help with question 6 pls

Pls help me I will make you brain
Help with question 6 plssss

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:00

The angle of a triangle are given as 6x,(x-3), and (3x+7). find x then find the measures of the angles

Answers: 2

Answer

Mathematics, 21.06.2019 22:00

Can you me find the slope! (30 points)

Answers: 2

Answer

Mathematics, 21.06.2019 22:00

Which of the following is an example of conditional probability

Answers: 3

Answer

Mathematics, 21.06.2019 23:00

Either enter an exact answer in terms of \piπ or use 3.143.14 for \piπ and enter your answer as a decimal.

Answers: 2

Answer

You know the right answer?

Pls help me I will make you brain

Help with question 6 pls
...

Questions

Mathematics, 05.11.2020 18:40

What number is 3 units to the right of 2 on the number line? A number line from negative seven to seven is shown. A point is plotted at two....

Mathematics, 05.11.2020 18:40

Kenny is practicing for a typing test to obtain a job as a paralegal. The number of words he can type is proportional to the number of minutes. If the...

English, 05.11.2020 18:40

The main idea of paragraph 11 is that... a. it is very easy to go to heaven and no one should miss the opportunity. b. heaven is full of...

Business, 05.11.2020 18:40

Marple Company's budgeted production in units and budgeted raw materials purchases over the next three months are given below: January February March...

History, 05.11.2020 18:40

Who was the 12th president of the USA...

Mathematics, 05.11.2020 18:40

Solve 3x + y = 1 for y*...

English, 05.11.2020 18:40

Which element of "Mary's Flag" is developed more fully in "A Dramatic Flag"? A. the role of Philadelphia in the establishment of a new governme...

Mathematics, 05.11.2020 18:40

How many solutions are there to the equation below? x=-64 A. -8 B. O c. 8 D. 16 E. 2

Business, 05.11.2020 18:40

Jeremy's level of satisfaction from consuming the first cookie was 25 utils. The second cookie increased the level of satisfaction by 20 utils. Jeremy...

English, 05.11.2020 18:40

She told fellow scientists and friends that “knowing what I do, I have no choice but to set it down to be read.” Select ALL the conclusions about Cars...

Physics, 05.11.2020 18:40

A 10 kg object is subjected to two forces F1 and F2. F1 has a magnitude of 20 N and acts straight upward and F2 has a magnitude of 30 N at 30 degrees...

Biology, 05.11.2020 18:40

Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3' Encoded within the partial mRNA s...

Biology, 05.11.2020 18:40

How do acacia trees communicate with each other in response to insect attack? A) They produce a gas called ethylene. B) They release pollen.

Mathematics, 05.11.2020 18:40

I need help with these too ...

Mathematics, 05.11.2020 18:40

Drag and drop the expressions into the boxes to correctly complete the proof of the polynomial identity.(x^2-y^2)^2+x^4+y^4=2(x^4- x^2y^2y^4)...

Physics, 05.11.2020 18:40

Cfare nxitimi shkakton forca F=40N, qe vepron neme mase m=10kg??...

Mathematics, 05.11.2020 18:40

Use approximation to find the square root to the nearest hundredth. 131...

Mathematics, 05.11.2020 18:40

Please help and add steps i’m stuck :( ...

Business, 05.11.2020 18:40

Savvy Sightseeing had beginning equity of $72,000; revenues of $90,000, expenses of $65,000, and dividends to stockholders of $9,000. There were no st...

Chemistry, 05.11.2020 18:40

“What ion does Magnesium (Mg) become?” A. Mg1- B. Mg2- C. Mg1+ D. Mg2+...

More questions: Mathematics Another questions

Pls help me I will make you brain Help with question 6 pls

Answers

Another question on Mathematics

Pls help me I will make you brain

Help with question 6 pls