![subject](/tpl/images/cats/biologiya.png)
Biology, 05.11.2020 18:40 jayjay2006
Below is a partial mRNA sequence. Use it to answer the following questions.
5' - UGGUCGGCGAGAACGAAAGCGC - 3'
Encoded within the partial mRNA sequence is a region of the protein with the amino acid sequence (N-term...G-E-N-E-S...C-term).
What is the correct reading frame for this mRNA? (Note that the reading frame may not begin with the first base in the partial sequence. It may be necessary to view codons further downstream to find the amino acid sequence N-term...G-E-N-E-S...C-term.)
1. 5' - U | GGU | CGG | CGA | GAA | CGA | AAG | CGC | - 3'
2. 5' - | UGG | UCG | GCG | AGA | ACG | AAA | GCG | C - 3'
3. 5' - UG | GUC | GGC | GAG | AAC | GAA | AGC | GC - 3'
4. 5' - UGGU | CGGC | GAGA | ACGA | AAGC | GC - 3'
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 15:30
15 points come and ! which characteristic describes all bacteria? a rod-shaped b microscopic c multicellular d autotrophic
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 16:30
Melissa lives in a town called greendale. she discovers that when she lights a match and holds it near her kitchen faucet, the little flame grows into a larger fire. melissa is surprised because she thought the water would extinguish the flame rather than ignite it further. her mother tells her that the water might be contaminated with dissolved methane, a primary component in natural gas. melissa investigates the matter and finds that cases of methane contamination started shortly after a company began fracking for natural gas in the area. based on this information, which three statements are plausible consequences of fracking in greendale?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:00
Idon’t know the answer and i’ve been stuck on it for a while now skskskskks
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:50
Which was most likely an effect on society that resulted from improvements in blood handling during world war i and world war ii?
Answers: 1
You know the right answer?
Below is a partial mRNA sequence. Use it to answer the following questions.
5' - UGGUCGGCGAGAACGAAA...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 20.11.2020 08:30
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 20.11.2020 08:30
![question](/tpl/images/cats/ekonomika.png)
Business, 20.11.2020 08:30
![question](/tpl/images/cats/mat.png)
Mathematics, 20.11.2020 08:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 20.11.2020 08:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 20.11.2020 08:30
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 20.11.2020 08:30
![question](/tpl/images/cats/mkx.png)
Arts, 20.11.2020 08:30