Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3'
Encoded within the partial mRNA sequence is a region of the protein with the amino acid sequence (N-term...G-E-N-E-S...C-term).
What is the correct reading frame for this mRNA? (Note that the reading frame may not begin with the first base in the partial sequence. It may be necessary to view codons further downstream to find the amino acid sequence N-term...G-E-N-E-S...C-term.)
1. 5' - U | GGU | CGG | CGA | GAA | CGA | AAG | CGC | - 3'
2. 5' - | UGG | UCG | GCG | AGA | ACG | AAA | GCG | C - 3'
3. 5' - UG | GUC | GGC | GAG | AAC | GAA | AGC | GC - 3'
4. 5' - UGGU | CGGC | GAGA | ACGA | AAGC | GC - 3'

the correct answer is c   with the systems

human didn't come from monkeys man i hate these stupid teachers

answers are:

lysogenic     viral dna merges with host cell dna

lysogenic     no symptoms

lytic               viral dna takes over

lysogenic     virus does not destroy host cell

lytic               virus destroys host cell

lytic               induces symptoms of viral infection

lysogenic       cell reproduces and spreads provirus

question#1

ans:

cell is the basic unit of organization of all living things. cells are often called the building block of life and it is the smallest unit of life. the study of cell is called cell biology. cell consists of cytoplasm enclosed within membrane, which contain bio-molecules such as proteins and nucleic acid.

two third of cell is water, which means that two-third of your whole body is water. the rest is the mixture of molecules, mainly proteins, lipids and carbohydrates.

question#2

ans:

organ:

an organ is a group of tissues specialized to form a functional unit. an example is the heart in animals.

organ system:

an organ system is a group of several organs whose functions are synchronized to release an effective action in a living organism. an example is digestive system.

question#3

different systems perform different function at tissue level. for example, the respiratory system facilitates breathing. in the alveoli tissue of the lungs, the exchange of oxygen and carbon dioxide molecules between the air and the bloodstream occurs by passive transport, so that oxygen is taken in and carbon dioxide and water are removed. different systems of the body carry out different functions. for example, your digestive system is responsible for taking in and processing food, while your respiratory system working with your circulatory system is responsible for taking up oxygen and getting rid of carbon dioxide.

question#4

different systems perform different function at tissue level. for example, the respiratory system facilitates breathing. in the alveoli tissue of the lungs, the exchange of oxygen and carbon dioxide molecules between the air and the bloodstream occurs by passive transport, so that oxygen is taken in and carbon dioxide and water are removed. different systems of the body carry out different functions. for example, your digestive system is responsible for taking in and processing food, while your respiratory system—working with your circulatory system is responsible for taking up oxygen and getting rid of carbon dioxide.

question#5

our body works because of the interactions that happen between organs and organ systems.  

for example:  

the heart to regulate blood flow throughout the body. the blood carries oxygen and nutrients to the cells and carries carbon dioxide and waste away from the cells. body systems work together in maintaining a constant internal environment. when this balance is disrupted, the body systems may not function properly, and human health can suffer.   you start to feel bad.