Mathematics, 31.10.2019 15:31 marci30

Aziz and tuan collected 3600 bottles for recycling last year. aziz collected 5 times as many bottles as tuan. how many bottles did tuan collect?

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 13:00

In the diagram below, dab and dac are adjacent angles. if mdac = 25°, what is mdab in degrees? what is mbac in degrees?

Answers: 3

Answer

Mathematics, 21.06.2019 13:30

Rose drew a regression line for this paired data set. her line passed through (1, 2) and (3, 5) . what is the equation of rose's regression line?

Answers: 1

Answer

Mathematics, 21.06.2019 15:20

Beth took out a $20,000 loan for college she is borrowing money from two banks. bank a charges an interest rate of 8.5% bank b charges and interest rate of 10.5% after one year alice owes $1860 in interest how much money did she borrow from bank a

Answers: 3

Answer

Mathematics, 21.06.2019 17:30

Hiroaki wants to find 3 3/4 - 7/8 explain why he must rename 3 3/4 to do the subtraction.

Answers: 3

Answer

You know the right answer?

Aziz and tuan collected 3600 bottles for recycling last year. aziz collected 5 times as many bottles...

Questions

English, 20.07.2019 06:00

Would someone answer this question will be and also will pick ( be honest)...

Mathematics, 20.07.2019 06:00

Acoach purchases 47 hats for his players and their families at a total cost of $302. the cost of a small hat is $5.50. a medium hat costs $6.00. a lar...

Chemistry, 20.07.2019 06:00

What is this kind of acid bases reaction called...

History, 20.07.2019 06:00

Read the statement from emerson's "self-reliance," and then answer the question. "power ceases in the instant of repose; it resides in the moment of...

English, 20.07.2019 06:00

Give examples from romeo and juliet...

Biology, 20.07.2019 06:00

Normal hemoglobin dna - cacgtggactgaggactcctc what is the normal hemoglodin acid- normal hemoglobin a. a sequnce for figuring out rna a binds with...

History, 20.07.2019 06:00

The event that started the migration of many cubans to florida was a. a severe drought. b. the cuban missile crisis. c. the cuban revolution. d. a des...

English, 20.07.2019 06:00

Consider the complex character tajima shume in “tajima.” how do tajima’s actions and interactions advance the plot and develop a theme in the story?...

Chemistry, 20.07.2019 06:00

Recall that your hypothesis is that these values are the fraction of atoms that are still radioactive after n half-life cycles. record in the appropri...

Chemistry, 20.07.2019 06:00

Recall that your hypothesis is that these values are the fraction of atoms that are still radioactive after n half-life cycles. record in the appropri...

Biology, 20.07.2019 06:00

Match the genes with their linkage ability....

Mathematics, 20.07.2019 06:00

Hello can you me posted picture of question...

Mathematics, 20.07.2019 06:00

Convert. if necessary, round to the nearest tenth. (recall: 1 mi ≈ 1.61 km) km/h ~ 10 mi/h...

History, 20.07.2019 06:00

What from of travel greatly with the industrialization of north america in the 1800s?...

History, 20.07.2019 06:00

When the government learned that striking workers were turning violent...

English, 20.07.2019 06:00

Which genre would be most appropriate for someone trying to inform the community about the potential benefits of a revitalized city park...

Mathematics, 20.07.2019 06:00

The figure shows five polygons: abcde, fghij, klmno, pqrst, and uvwxy. polygon cannot be mapped onto the others by similarity transformations. nextre...

Mathematics, 20.07.2019 06:00

Currently requiring a little on this, would not mind any answer < 3

History, 20.07.2019 06:00

List some important ideas that the giver includes. why did you choose those ideas?...

English, 20.07.2019 06:00

What term best describes twain's exploration of social-class structure in the adventures of huckleberry finn? inferred meaning figure of speech theme...

More questions: Mathematics Another questions