Normal hemoglobin dna - cacgtggactgaggactcctc what is the normal hemoglodin acid- normal hemoglobin a. a sequnce for figuring out rna a binds with u c binds with g

The dna in a cell’s nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well as proteins that are targeted for secretion from the cell. for example, consider these two proteins: phosphofructokinase (pfk) is an enzyme that functions in the cytoplasm during glycolysis. insulin, a protein that regulates blood sugar levels, is secreted from specialized pancreatic cells. assume that you can track the cellular locations of these two proteins from the time that translation is complete until the proteins reach their final destinations.for each protein, identify its targeting pathway: the sequence of cellular locations in which the protein is found from when translation is complete until it reaches its final (functional) destination. (note that if an organelle is listed in a pathway, the location implied is inside the organelle, not in the membrane that surrounds the organelle.)