Mathematics, 18.03.2021 01:50 carolinamleal04

A bag contains 12 blue marbles, 15 red marbles, and 13 purple marbles. If Monty randomly draws a marble from the bag (and puts it back) 20 times, how many times should he expect to pull a blue marble?

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:00

If i have a 24 in loaf of bread and i cut it into two pieces one 9 in how long was the other

Answers: 2

Answer

Mathematics, 21.06.2019 17:30

Find the zero function by factoring (try to show work) h(x)=-x^2-6x-9

Answers: 2

Answer

Mathematics, 21.06.2019 18:30

The base of a triangle is 8 1 3 meters and the height of the triangle is the fourth root of 16 meters meters. what is the area of the triangle?

Answers: 3

Answer

Mathematics, 21.06.2019 20:10

What additional information could be used to prove abc =mqr using sas? check all that apply.

Answers: 1

Answer

You know the right answer?

A bag contains 12 blue marbles, 15 red marbles, and 13 purple marbles. If Monty randomly draws a mar...

Questions

Biology, 11.12.2019 18:31

Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the sequence taatacgactcactataggg has a melting temperature...

Business, 11.12.2019 18:31

Vesting refers to; a. how long until an employee owns any employer contributions to the employee's pension plan. b. how long until an e...

Chemistry, 11.12.2019 18:31

For which of the following will the entropy of the system increase? a. condensation of steam b. reaction of magnesium with oxygen to for...

Chemistry, 11.12.2019 18:31

What is wrong with the following mechanism? h2o 2) br br there is no leaving group, so there should be no arrows. a. b. the arrow should be removing...

Mathematics, 11.12.2019 18:31

When light passes from a more-dense to a less-dense medium—from glass to air, for example—the angle of refraction predicted by snell's law can be 90°...

Physics, 11.12.2019 18:31

When a hammer thrower releases her ball, she is aiming to maximize the distance from the starting ring. assume she releases the ball at an angle of 31...

Mathematics, 11.12.2019 18:31

What is the main difference between the explanation for the effect size for a one-way between-subjects anova and the one-way repeated measures anova?...

History, 11.12.2019 18:31

Many changes that have happened in american history started with one person standing up for what they believed in and others joining them in their cau...

Business, 11.12.2019 18:31

Abeekeeper lives adjacent to an apple orchard. the orchard owner benefits from the bees because each hive pollinates about one acre of apple trees. th...

Business, 11.12.2019 18:31

When evaluating the performance of rick, a buyer for the men’s clothing department, believing that rick is often late because his children are sick b...

Chemistry, 11.12.2019 18:31

Abottle of vintage red wine has lost its label. the concentration of a radioactive isotope of hydrogen (hydrogen-3 or tritium) in the wine is 0.34 tim...

Business, 11.12.2019 18:31

Abrilliant young scientist is killed in a plane crash. it is anticipated that he could have earned $330,000 a year for the next 50 years. the attorney...

Mathematics, 11.12.2019 18:31

Today, everything at a store is on sale. the store offers a 20% discount. if the regular price of an item is x dollars, what is the discount price in...

Biology, 11.12.2019 18:31

Red -green color blindness is an x linked recessive disorder . since normal vision is dominant, it is typically represented as x8. if a normal female...

Mathematics, 11.12.2019 18:31

You are evaluating the effectiveness of improvements your company has made to a new mobile app. the 95% confidence interval for the difference between...

Mathematics, 11.12.2019 18:31

Greta is looking for a new fishing pole for an upcoming trip to the grand canyon. she found the model she likes at a loccal sporting goods store. the...

Business, 11.12.2019 18:31

Revenue: $500,000 pants: $250,000 packaging: $1,000 advertising: $500 rent: $1,000 depreciation: $25 assume the company wants to launch a "sprin...

History, 11.12.2019 18:31

The 13th amendment ended slavery in the united states. what would be the best reason congress decided to amend the constitution to make this practice...

Mathematics, 11.12.2019 18:31

Acollege student has 7 days remaining before final examinations begin in her four courses, and she wants to allocate this study time as a effectively...

Business, 11.12.2019 18:31

What kind of leader do i want to follow during a time of change? i want to follow a servant-leader. why? because servant-leaders do not use organiza...

More questions: Mathematics Another questions