Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the sequence taatacgactcactataggg has a melting temperature (tm) of 59 °c. if an rna duplex oligonucleotide of identical sequence (substituting u for t) is constructed, will its melting temperature be higher or lower?

it will be higher

Explanation:

It will be higher because RNA has a higher thermal stability than DNA

plato users

given bodies of water

pacific / arctic / indian / southern

[ a ] the caribbean sea

[ b ] the northern ocean

[ c ] the atlantic ocean

[ d ] the barents sea

with this being the given answers

the answer is a) cell division.

hope this !