subject

Mathematics, 18.02.2021 22:50 ssrt8771

-1.6α + 2a^4 + 8.1a^3 In standard form

My options are
2a^4 + 8.1a + 1.6a

2a^4 - 1.6a + 8.1a^3

8.1a^3 + 2a^4 + 1.6a

Any help is appreciated greatly :)

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 18:00

Based on the graph, what is the initial value of the linear relationship? a coordinate plane is shown. a line passes through the y-axis at -2 and the x-axis at 3.

Answers: 3

question

Mathematics, 21.06.2019 23:30

Use the ratio test to determine whether ∑n=14∞n+2n! converges or diverges. (a) find the ratio of successive terms. write your answer as a fully simplified fraction. for n≥14, limn→∞∣∣∣an+1an∣∣∣=limn→∞.

Answers: 3

question

Mathematics, 21.06.2019 23:30

In the diagram, ab is tangent to c, ab = 4 inches, and ad = 2 inches. find the radius of the circle.

Answers: 1

question

Mathematics, 21.06.2019 23:40

Klmn and pqrs are similar trapezoids. which side of pqrs corresponds to lm

Answers: 1

You know the right answer?

-1.6α + 2a^4 + 8.1a^3 In standard form

My options are
2a^4 + 8.1a + 1.6a
<...

Questions

question

Computers and Technology, 10.03.2020 08:08

Ralph, the manager of a busy hardware store, knows that he needs to entrust many of his tasks to managers and other employees. is this process of ass...

question

Mathematics, 10.03.2020 08:08

We have three types of birds at three prices: The large bird costs 3 coins, the middle sized bird costs 2 coins and four chicks cost 1 coin. Find the...

question

Health, 10.03.2020 08:08

The cross bridge cycle is a series of molecular events that occur after excitation of the sarcolemma. What is a cross bridge? View Available Hint(s) T...

question

Biology, 10.03.2020 08:08

The structure of the spinal cord can be described as (1) composed of thirty-one segments (2) having a cervical enlargement, lumbar enlargement, and tw...

question

Business, 10.03.2020 08:08

On September 1, Year 1, Orville Corporation has unrestricted Retained Earnings of $8,300,000, Appropriated Retained Earnings of $5,300,000, Cash of $9...

question

Mathematics, 10.03.2020 08:08

Men have head breadths that are normally distributed with a mean of 6.0 inches and a standard deviation of 1.0 inch. Engineers must consider the bread...

question

Mathematics, 10.03.2020 08:08

Consider a sample of rubber bands. Their weights are measured and found to have a variance of 2.57. Give a point estimate for the population variance...

question

Biology, 10.03.2020 08:08

are multiple arteries that fuse in order to serve a single capillary network. are multiple arteries that fuse in order to serve a single capillary ne...

question

Computers and Technology, 10.03.2020 08:08

Question 4. Use simulate_several_key_strikes 1000 times, each time simulating the monkey striking 11 keys. Compute the proportion of times the monkey...

question

Business, 10.03.2020 08:08

Given the following term structure of risk-free interest rates today, what would you expect the interest rate to be on a two year bond three years fro...

question

Computers and Technology, 10.03.2020 08:08

A(n) is a calculation (using encryption technologies) based on the contents of a disk or file. They are engineered so that even small changes in the...

question

Physics, 10.03.2020 08:08

An airplane speeds down a runway lined by red and green lights as it prepares for takeoff. In the distance, the parallel red and green lights appear t...

question

Social Studies, 10.03.2020 08:08

Many different approaches have been suggested to aid the analyst in identifying a set of candidate objects for the structural model. The four most com...

question

Business, 10.03.2020 08:08

An angry customer has emailed Kurtis wanting to know why the custom luggage he ordered three weeks ago hasn't arrived yet. When Kurtis looks up the or...

question

Biology, 10.03.2020 08:08

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperatur...

question

Business, 10.03.2020 08:08

You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The bet...

question

Mathematics, 10.03.2020 08:08

Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer lab...

question

Business, 10.03.2020 08:08

River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assum...

question

Social Studies, 10.03.2020 08:08

Assume that the union wage already exceeds the market-clearing wage. If the union wage is increased, holding other factors constant, then the number u...

question

Business, 10.03.2020 08:08

In which type of operations are you likely to see, at most, only minor variations in the product or service being produced using the same process and...

More questions: Mathematics Another questions

Questions on the website: 13722367