Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 8C. If an RNA duplex oligonucleotide of identical sequence (sub-stituting U for T) is constructed, will its melting temperature be higher or lower?

Which units ate used to measure both velocity and speed? check all that apply

Sediment layers stop lateral spreading when: they encounter a barrier they encounter an opposing current they run out of additional sedimentary material

Astudent wants to test the hypothesis that fertilizer improves the growth rate of grass seeds. to test this hypothesis, the student put the same amount of grass seed in 3 containers with the same type of soil. the student measured the growth at the end of the week. all plants received equal amounts of water and sunlight. if you were asked to graph this data, what would you place on the x-axis? a. fertilizer b. water c. plant growth d. week one