Mathematics, 10.12.2020 23:00 nuconteaza119

Can someone plz help with this

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 16:10

Convert 50 kilogram to pounds. (the conversion factor from kilogram to pound is 2.2046.) a. 52.2 lb. b. 110.2 lb. c. 22.6 lb. d. 47.8 lb.

Answers: 1

Answer

Mathematics, 21.06.2019 17:00

Acylinder and its dimensions are shown. which equation can be used to find v, the volume of the cylinder in cubic centimeters?

Answers: 1

Answer

Mathematics, 21.06.2019 18:20

Type the correct answer in each box. use numerals instead of words. if necessary, use / for the fraction bar. consider the given table.

Answers: 1

Answer

Mathematics, 21.06.2019 21:00

How do i put 3(x+7) in distributive property

Answers: 1

Answer

You know the right answer?

Can someone plz help with this
...

Questions

Mathematics, 05.11.2020 18:40

Angelica has a bank account. Deposit $40 on Monday. Then, Tuesday through Saturday, deposit $15 each weekday. And on Sunday she buys a kit for her mat...

History, 05.11.2020 18:40

Read the text below from the Article IV of the U. S. Constitution: Amendment IV – Search and Seizure The right of the people to be secure in th...

English, 05.11.2020 18:40

In paragraph 9, it can be inferred that... a. People in this congregation like to judge each other. b. Edwards thinks no one can know whe...

Physics, 05.11.2020 18:40

01100011 01100001 01101110 00100000 01100101 01100001 01110010 01110100 01101000 00100000 01100010 01100101 01101110 01100100 01100101 01110010 011100...

History, 05.11.2020 18:40

Complete each sentence or statement. The city of became the city of New York....

English, 05.11.2020 18:40

Will give brainliest Read the following excerpt from "Ellis Island" by Barbara Davis-Pyle. Then I smiled because all of the questions were over. The...

Spanish, 05.11.2020 18:40

Observa y escribe. Look at the picture and describe what you see and its location.

Mathematics, 05.11.2020 18:40

What number is 3 units to the right of 2 on the number line? A number line from negative seven to seven is shown. A point is plotted at two....

Mathematics, 05.11.2020 18:40

Kenny is practicing for a typing test to obtain a job as a paralegal. The number of words he can type is proportional to the number of minutes. If the...

English, 05.11.2020 18:40

The main idea of paragraph 11 is that... a. it is very easy to go to heaven and no one should miss the opportunity. b. heaven is full of...

Business, 05.11.2020 18:40

Marple Company's budgeted production in units and budgeted raw materials purchases over the next three months are given below: January February March...

History, 05.11.2020 18:40

Who was the 12th president of the USA...

Mathematics, 05.11.2020 18:40

Solve 3x + y = 1 for y*...

English, 05.11.2020 18:40

Which element of "Mary's Flag" is developed more fully in "A Dramatic Flag"? A. the role of Philadelphia in the establishment of a new governme...

Mathematics, 05.11.2020 18:40

How many solutions are there to the equation below? x=-64 A. -8 B. O c. 8 D. 16 E. 2

Business, 05.11.2020 18:40

Jeremy's level of satisfaction from consuming the first cookie was 25 utils. The second cookie increased the level of satisfaction by 20 utils. Jeremy...

English, 05.11.2020 18:40

She told fellow scientists and friends that “knowing what I do, I have no choice but to set it down to be read.” Select ALL the conclusions about Cars...

Physics, 05.11.2020 18:40

A 10 kg object is subjected to two forces F1 and F2. F1 has a magnitude of 20 N and acts straight upward and F2 has a magnitude of 30 N at 30 degrees...

Biology, 05.11.2020 18:40

Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3' Encoded within the partial mRNA s...

Biology, 05.11.2020 18:40

How do acacia trees communicate with each other in response to insect attack? A) They produce a gas called ethylene. B) They release pollen.

More questions: Mathematics Another questions