subject

Mathematics, 24.10.2019 11:43 MyaMya12

Find the greatest common factor of 30 and 105.

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 15:00

Factor completely. 4p^2 + 36p + 81 express the answer in the form (ap + b)^2

Answers: 3

question

Mathematics, 21.06.2019 22:10

Write the function for the graph. (1.8) (0,4)

Answers: 3

question

Mathematics, 21.06.2019 22:30

Need same math paper but the back now i hope your able to read it cleary i need with hw

Answers: 1

question

Mathematics, 21.06.2019 23:30

Katie wants to collect over 100 seashells. she already has 34 seashells in her collection. each day, she finds 12 more seashells on the beach. katie can use fractions of days to find seashells. write an inequality to determine the number of days, dd, it will take katie to collect over 100 seashells.

Answers: 1

You know the right answer?

Find the greatest common factor of 30 and 105....

Questions

question

Engineering, 06.12.2021 08:40

6.03 Discussion: Then & Now - Safety Discussion Topic I'm Done In this unit, you have learned about the evolution of the industry’s...

question

Biology, 06.12.2021 08:40

Which statement best describes adaptation: A. A lily suddenly mutates its tissues to store more water in a drought. B. Fish swim away from sudden sour...

question

English, 06.12.2021 08:40

What do these lines from stanza 5 reveal about the Pardoner? I stand up like a scholar in a pulpit, And when the ignorant people all do sit,

question

Mathematics, 06.12.2021 08:40

The amount of milk available per child in a day care center is given by the function Mlu)= where x is the number of children and is the quantity of...

question

Mathematics, 06.12.2021 08:40

Select of the equivalent representations of 1/10x10x10...

question

English, 06.12.2021 08:40

class 6to 11 students come here I will give you notes class is started come plz plz and it is free class no fee need fast come students plz plz plz pl...

question

Mathematics, 06.12.2021 08:40

A 4. An architect made a scale drawing on a grid of the front of an arch for a public park. Each box on the architect's grid measures 1...

question

Chemistry, 06.12.2021 08:40

Please help me with this I need this asap because submission of mine is 4:00 pm

question

Mathematics, 06.12.2021 08:40

Newton's Second Law of Motion states that the acceleration of an object is directly proportional to the force exerted on the object. If an object ac...

question

Mathematics, 06.12.2021 08:40

In general, the mechanical advantage of a simple machine is... A. please help quick the amount of force needed with the machine...

question

Mathematics, 06.12.2021 08:40

Pls help asap thx 1. Mr. Voeller and his band want to play at a venue in Oakland, but it is a gig that will last all night long. As a teacher...

question

History, 06.12.2021 08:40

From 1775-1825 what issue most divided the United States?...

question

History, 06.12.2021 08:40

Plz answer quick if u can i need it soon ...

question

Mathematics, 06.12.2021 08:40

What is solve 10<-2/3(9+12b)...

question

Mathematics, 06.12.2021 08:40

I need help what is the square root of 5*12/5...

question

Computers and Technology, 06.12.2021 08:40

Fill in the blacks 1-9 are my answer options for 10-12

question

Biology, 06.12.2021 08:40

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts):

question

Mathematics, 06.12.2021 08:40

I need help finals are crushing me pls help ...

question

Mathematics, 06.12.2021 08:40

V. Directions: Answer the following questions. Show your solution, 10. What is the smallest decimal number with two decimal places that becomes 0.5...

question

Mathematics, 06.12.2021 08:40

Help please i dont want to fail ...

More questions: Mathematics Another questions

Questions on the website: 13722361