Biology, 06.12.2021 08:40 sadsociety41
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5'
Type of mutation ( 3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
2. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5'
Type of mutation ( 3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
3. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation (3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation ( 3pts) :
Amino acid ( 3pts):
Type of mutation ( 3pts):
5. What is the difference between a point mutation and a frameshift mutation? 4pts
Answers: 2
Biology, 22.06.2019 06:20
The science for classifying and naming organisms is known as
Answers: 2
Biology, 22.06.2019 07:20
If your blood becomes too concentrated with iona, what will happen to the red blood cells
Answers: 2
Biology, 22.06.2019 10:30
During a fierce storm a large number of tall trees on an island are uprooted by the wind and die. most of the trees on the island are now short trees and produce seeds that grow into short trees. what concept is shown in this example? question 5 options: natural selection artificial selection genetic engineering gene splicing
Answers: 2
Biology, 22.06.2019 11:00
Examine the air pressure map. which type of line is shown on the map?
Answers: 1
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACATCCGCTTACGTCTGA...
History, 22.04.2020 23:19
Chemistry, 22.04.2020 23:20
History, 22.04.2020 23:20
Mathematics, 22.04.2020 23:20
Mathematics, 22.04.2020 23:20
English, 22.04.2020 23:20
Mathematics, 22.04.2020 23:20
Mathematics, 22.04.2020 23:20