Mathematics, 20.05.2020 06:59 ozzy55

Scientific notation help!!20 points

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 15:20

With this one. will mark brainliest

Answers: 1

Answer

Mathematics, 21.06.2019 18:00

If 1/√5+1/√5+1=p+q√r , find the values of p, q and r

Answers: 2

Answer

Mathematics, 21.06.2019 20:00

Can someone factor this fully? my friend and i have two different answers and i would like to know if either of them is right. you in advance. a^2 - b^2 + 25 + 10a

Answers: 1

Answer

Mathematics, 22.06.2019 00:30

Pls as soon as ! will award brainliest and 20 ! also the answer is not 22.5 degrees! find the value of x in each case:

Answers: 3

Answer

You know the right answer?

Scientific notation help!!20 points
...

Questions

English, 16.04.2020 23:14

Miss Meriwether of the missionary circle complains about her cooks and fieldhands what does that tell us about her...

Business, 16.04.2020 23:14

Eastern Corporation has $1,000 par value bonds with 4 years to maturity. The bonds pay an 8% coupon rate with semi-annual coupon interest payments. Th...

Mathematics, 16.04.2020 23:14

Gravel is being dumped from a conveyor belt at a rate of 20 cubic feet per minute. It forms a pile in the shape of a right circular cone whose base di...

Spanish, 16.04.2020 23:14

10 citas textuales donde puedan ubicar figuras heroicas...

Mathematics, 16.04.2020 23:14

F(x) = (x – 4)(x + 2)? which point is an x intercept of the quadratic function...

Mathematics, 16.04.2020 23:14

The measure of a central angle is 80 degrees. The length of the radius is 40 mm. Determine the arc length....

Biology, 16.04.2020 23:14

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

Chemistry, 16.04.2020 23:14

Consider N O2 molecules in a container of volume V at a pressure of P=1 atm and a temperature of T=298K. a. Calculate the collision frequency Z1 of a...

Mathematics, 16.04.2020 23:14

A researcher records the repair cost for 2020 randomly selected stereos. A sample mean of $57.17$ 57.17 and standard deviation of $19.26$ 19.26 are su...

Mathematics, 16.04.2020 23:14

Look at the pentagonal numbers. Use finite differences to determine which function represents the pattern. f(x) = 1.5x + 0.5x f(x) =...

Mathematics, 16.04.2020 23:14

Katie and Tyler are working at their lemonade stand. An hour ago, their pitcher of lemonade was 78 full. Since then, they have sold 12 of a pitcher of...

History, 16.04.2020 23:14

Given what you know about the outcome of the war, do you think you made the right decision? Consider the personal reasons for your choice as well....

Mathematics, 16.04.2020 23:14

Find the numeral preceding and succeeding each of the following numerals: 540 base six 100000 base 3 EEE base 12...

History, 16.04.2020 23:14

What do you consider the biggest challenge(s) facing Americans today? Why do you believe the way that you do?...

Mathematics, 16.04.2020 23:14

Select the correct answer from each drop-down menu. Consider the expressions given below. A. 2.13 – 12 – 63 B. 213 + 8x + 4 C....

Mathematics, 16.04.2020 23:14

Find the value of X in trapezoid ABCD. Question 24

Mathematics, 16.04.2020 23:14

Which expressions are equivalent to 55% of 300?...

Biology, 16.04.2020 23:14

Which procedure would increase the validity of the conclusions from this experiment?...

English, 16.04.2020 23:15

What is the definition to metonymy?...

Mathematics, 16.04.2020 23:15

Experimental probability The following histogram summarizes the number of points Nate has scored each game this season. Number of games

More questions: Mathematics Another questions