subject
Biology, 16.04.2020 23:14 cpcoolestkid4

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment? (Recall that the stop codons are 5' TAA, 5' TAG, and 5' TGA.)

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 23:00
Use this new information to determine the parents’ genotypes (indicated by red arrows). then calculate the probabilities that the second male offspring will have each condition. drag one pink label to each pink target and one blue label to each blue target. then use the white labels to answer questions 1 and 2. labels can be used once, more than once, or not at all.
Answers: 3
question
Biology, 22.06.2019 10:00
14. which of the following codons code for threonine? a. ucg b. ugu c. cga d. aca
Answers: 2
question
Biology, 22.06.2019 12:30
The direct energy source that drives atp synthesis during respiratory oxidative phosphorylation is
Answers: 1
question
Biology, 22.06.2019 14:00
The polio virus can cause skeletal muscle paralysis by destroying neuron cell bodies. what area of the spinal cord is destroyed
Answers: 3
You know the right answer?
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small...
Questions
question
Mathematics, 01.12.2021 22:00
Questions on the website: 13722363