Mathematics, 29.06.2019 20:30 jojo10092003

Naruto is choosing between two venues that will deliver food to his house. with probability 1/3 he will choose ramen mania (r), and with probability 2/3 he will choose sushi (s). if he chooses r, 15 minutes after making the call, the remaining time it takes the food to arrive is exponentially distributed with average 10 minutes. if he orders s, 10 minutes after making the call, the time it takes the food to arrive is exponentially distributed with an average of 12 minutes. given that he has already waited 25 minutes after calling, and the food has not arrived, what is the probability that he ordered from r?

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 18:30

[10 points, algebra 2-simplifying complex fractions]according to my answer key the restrictions are -1 and 4. but why not positive 1?

Answers: 1

Answer

Mathematics, 21.06.2019 23:30

Which term applies to agb and dge? a. obtuse b. supplementary c. complementary d. vertical

Answers: 1

Answer

Mathematics, 22.06.2019 00:00

Given the diagram below, michael writes, "segment ac is congruent to segment ac." which of the following reasons allow him to write this statement?

Answers: 1

Answer

Mathematics, 22.06.2019 00:00

Solve for x where 0 equation: cot^2x+2cotx+1=0

Answers: 1

Answer

You know the right answer?

Naruto is choosing between two venues that will deliver food to his house. with probability 1/3 he w...

Questions

Biology, 10.03.2020 08:08

One reason that the farmer could not mate these cloned sheep with eachother to increase the size of his flock...

Business, 10.03.2020 08:08

Assume that a U. S. firm can invest funds for one year in the United States at 12 percent or invest funds in Mexico at 14 percent. The spot rate of th...

Computers and Technology, 10.03.2020 08:08

Ralph, the manager of a busy hardware store, knows that he needs to entrust many of his tasks to managers and other employees. is this process of ass...

Mathematics, 10.03.2020 08:08

We have three types of birds at three prices: The large bird costs 3 coins, the middle sized bird costs 2 coins and four chicks cost 1 coin. Find the...

Health, 10.03.2020 08:08

The cross bridge cycle is a series of molecular events that occur after excitation of the sarcolemma. What is a cross bridge? View Available Hint(s) T...

Biology, 10.03.2020 08:08

The structure of the spinal cord can be described as (1) composed of thirty-one segments (2) having a cervical enlargement, lumbar enlargement, and tw...

Business, 10.03.2020 08:08

On September 1, Year 1, Orville Corporation has unrestricted Retained Earnings of $8,300,000, Appropriated Retained Earnings of $5,300,000, Cash of $9...

Mathematics, 10.03.2020 08:08

Men have head breadths that are normally distributed with a mean of 6.0 inches and a standard deviation of 1.0 inch. Engineers must consider the bread...

Mathematics, 10.03.2020 08:08

Consider a sample of rubber bands. Their weights are measured and found to have a variance of 2.57. Give a point estimate for the population variance...

Biology, 10.03.2020 08:08

are multiple arteries that fuse in order to serve a single capillary network. are multiple arteries that fuse in order to serve a single capillary ne...

Computers and Technology, 10.03.2020 08:08

Question 4. Use simulate_several_key_strikes 1000 times, each time simulating the monkey striking 11 keys. Compute the proportion of times the monkey...

Business, 10.03.2020 08:08

Given the following term structure of risk-free interest rates today, what would you expect the interest rate to be on a two year bond three years fro...

Computers and Technology, 10.03.2020 08:08

A(n) is a calculation (using encryption technologies) based on the contents of a disk or file. They are engineered so that even small changes in the...

Physics, 10.03.2020 08:08

An airplane speeds down a runway lined by red and green lights as it prepares for takeoff. In the distance, the parallel red and green lights appear t...

Social Studies, 10.03.2020 08:08

Many different approaches have been suggested to aid the analyst in identifying a set of candidate objects for the structural model. The four most com...

Business, 10.03.2020 08:08

An angry customer has emailed Kurtis wanting to know why the custom luggage he ordered three weeks ago hasn't arrived yet. When Kurtis looks up the or...

Biology, 10.03.2020 08:08

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperatur...

Business, 10.03.2020 08:08

You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The bet...

Mathematics, 10.03.2020 08:08

Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer lab...

Business, 10.03.2020 08:08

River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assum...

More questions: Mathematics Another questions