History, 23.11.2020 19:00 sog8jojo

2) Select the best answer. How has Europe’s water resources helped it become one of the most powerful regions in the world?

1. commercial success led to political power
2. all of these
3. encouraged commercial success
4. growth by means of extensive trade routes

Answers: 3

Show answers

Another question on History

History, 21.06.2019 15:30

In addition to carbon ,carbonate minerals contain

Answers: 1

Answer

History, 21.06.2019 22:30

The county could deny african americans the right to attend white schools on the basis of

Answers: 1

Answer

History, 22.06.2019 02:10

Describe the causes and effects of the war powers act

Answers: 1

Answer

History, 22.06.2019 02:30

Pl ! the term laissez-faire refers to the government’s approach, in the 1890s, to foreign policy affecting trade. economic policy affecting business. educational policy affecting schools. domestic policy affecting social reform.

Answers: 2

Answer

You know the right answer?

2) Select the best answer. How has Europe’s water resources helped it become one of the most powerf...

Questions

Mathematics, 22.05.2020 07:57

F(x) = x2. What is g(x)?...

Social Studies, 22.05.2020 07:57

ASAP 1. Describe and give an example of each of the following terms: civil law, criminal law, misdemeanor, felony. Type your answer here....

Biology, 22.05.2020 07:57

Do synthetic hormones, as in those used in birth control pills, don't affect the body and do the same thing as the natural hormone?...

English, 22.05.2020 07:57

Choose the Rhetorical Strategy that is described: When an author/speaker repeats a word or phrase to create emphasis *...

Social Studies, 22.05.2020 07:57

Which number BEST represents the Yellow Sea?...

Health, 22.05.2020 07:57

As Ms. Carlson returned the student papers she had graded, she was thinking about the fact that she had forgotten to pick up her dry cleaning on...

English, 22.05.2020 07:57

Dexters chicken would have been far more if he had just been able to from seasoning it with so much salt...

Business, 22.05.2020 07:57

Opportunity cost is best described by which of the following statements? Choose 1 Choose 1 (Choice A) The value...

Mathematics, 22.05.2020 07:57

Two sides of a triagle have a lengths 15cm and 19 cm. which measurement can be the length of the third side?...

English, 22.05.2020 07:58

What is Daisy's response to Gatsby's wealth?...

Chemistry, 22.05.2020 07:58

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please...

Geography, 22.05.2020 07:58

What are the crops grown in Greece are found on farmland A) on grabbed in southern Greece B)on more than 2,000islands ...

Biology, 22.05.2020 07:58

What is a cell cycle?...

Biology, 22.05.2020 07:58

Which adaptation pervents the darker moth from being visible to birds...

Biology, 22.05.2020 07:58

Which of the following statements are correct (select all that is correct) Each antibody is specific to the antigen Antibodies act a...

Computers and Technology, 22.05.2020 07:58

Please tell me a example totrobleshooting hard ware problem...

Law, 22.05.2020 07:58

Please answer all the questions

Mathematics, 22.05.2020 07:58

Answer needed fast plz can sum one pllz help me

Mathematics, 22.05.2020 07:58

What type of function is represented in the table?

Mathematics, 22.05.2020 07:58

What is the most appropriate level of accuracy for measuring the height of a tree? 381 feet 4. 38.27 feet 38.268 feet 38...

More questions: History Another questions

2) Select the best answer. How has Europe’s water resources helped it become one of the most powerful regions in the world? 1. commercial success led to political power 2. all of these 3. encouraged commercial success 4. growth by means of extensive trade routes

Answers

Another question on History

2) Select the best answer. How has Europe’s water resources helped it become one of the most powerful regions in the world?

1. commercial success led to political power
2. all of these
3. encouraged commercial success
4. growth by means of extensive trade routes