4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Plea...
Answers: 2
Another question on Chemistry
Chemistry, 22.06.2019 02:00
How many moles of magnesium is 3.01 x10^22 atoms of magnesium?
Answers: 1
Chemistry, 22.06.2019 02:40
Achange in the number of neutrons in an atom will change an blank . when the number of protons changes in an atom, a new element will form.
Answers: 2
Chemistry, 22.06.2019 06:00
An atom of lithium (li) and an atom of chlorine (cl) engage in a chemical reaction. which correctly describes the structure of the resulting chemical compound? hint: consider the class of each element. the chemical compound will have a network structure. the chemical compound will have triple bonds. the chemical compound will have a ball-and-stick structure. the chemical compound will have double bonds.
Answers: 2
Chemistry, 22.06.2019 23:30
With the largest atoms and the smallest number of valence electrons and with the smallest atoms and the greatest number of valence electrons are the most reactive. a. nonmetals; metals b. nonmetals; transition elements c. transition elements; metals d. metals; nonmetals
Answers: 3
You know the right answer?
Questions
Mathematics, 05.02.2021 18:30
Mathematics, 05.02.2021 18:30
Mathematics, 05.02.2021 18:30
Spanish, 05.02.2021 18:30
Spanish, 05.02.2021 18:30
Mathematics, 05.02.2021 18:30
Mathematics, 05.02.2021 18:30
Mathematics, 05.02.2021 18:30
Social Studies, 05.02.2021 18:30
Mathematics, 05.02.2021 18:30
Mathematics, 05.02.2021 18:30
Mathematics, 05.02.2021 18:30
History, 05.02.2021 18:30
