subject

History, 19.11.2020 18:40 AutismRobotrix1999

Why is Africa sometimes called “The Motherland”??

ansver

Answers: 1

Show answers

Another question on History

question

History, 21.06.2019 19:00

Need the draft was suspended largely because a. american public opinion opposed it. b. the president vetoed it. the supreme court declared it unconstitutional. d. world war ii ended.

Answers: 1

question

History, 22.06.2019 00:30

Which groups united to form the populist party

Answers: 1

question

History, 22.06.2019 01:30

Which of the following statements occurred last in the official overthrow of the russian provisional government in october of 1917? the bolsheviks campaigned for support of their political platform. the bolsheviks organized an assault and stormed the winter palace. the bolsheviks and trotsky’s militia seized key targets in petrograd. vladimir lenin established himself as the leader of the bolsheviks. i know the answers a and d are inccorect.

Answers: 2

question

History, 22.06.2019 05:30

Who coined the phrase “go west and grow with the country”?

Answers: 1

You know the right answer?

Why is Africa sometimes called “The Motherland”??...

Questions

question

Chemistry, 11.12.2019 18:31

The half life of radon-222 is 3.8 days. how much of a 100 gram sample is left after 15.2 days ?...

question

Chemistry, 11.12.2019 18:31

Which is the best analogy of a wave?...

question

Spanish, 11.12.2019 18:31

L select the word from the list that best fits the definition viene del mar....

question

Social Studies, 11.12.2019 18:31

Two pickles fell on the floor what did they say to each other...

question

Mathematics, 11.12.2019 18:31

Let x be the normal distribution with mean μ=−19 μ = − 19 and variance 16 16 for some value of z...

question

Mathematics, 11.12.2019 18:31

Which of the following is a logarithmic function?...

question

History, 11.12.2019 18:31

What type of music is traditional?...

question

Mathematics, 11.12.2019 18:31

Which of the following is not a step in finding the interest from a simple interest table? a. divide the principal by $100 to find the number o...

question

Chemistry, 11.12.2019 18:31

Can you find the quotient of 1/4 of 3...

question

Spanish, 11.12.2019 18:31

Select the word from the list that best fits the definition viene del mar....

question

Mathematics, 11.12.2019 18:31

The population parameters below describe the full-time equivalent number of students (ftes) each year at lake tahoe community college from 1976–1977 t...

question

Law, 11.12.2019 18:31

Researchers who study the causes of crime are called?...

question

Mathematics, 11.12.2019 18:31

Suppose a 95% confidence interval for the average amount of weight loss on a diet program for males is between 13.0 and 18.0 pounds. these results wer...

question

Business, 11.12.2019 18:31

Zhao co. has fixed costs of $255,000. its single product sells for $157 per unit, and variable costs are $107 per unit. the company expects sales of 1...

question

Chemistry, 11.12.2019 18:31

What is the concentration of a solution of hcl in which a 10.0 ml sample of acid required 50.0 ml of 0.150 m naoh for neutralization? what is the con...

question

Biology, 11.12.2019 18:31

Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the sequence taatacgactcactataggg has a melting temperature...

question

Business, 11.12.2019 18:31

Vesting refers to; a. how long until an employee owns any employer contributions to the employee's pension plan. b. how long until an e...

question

Chemistry, 11.12.2019 18:31

For which of the following will the entropy of the system increase? a. condensation of steam b. reaction of magnesium with oxygen to for...

question

Chemistry, 11.12.2019 18:31

What is wrong with the following mechanism? h2o 2) br br there is no leaving group, so there should be no arrows. a. b. the arrow should be removing...

question

Mathematics, 11.12.2019 18:31

When light passes from a more-dense to a less-dense medium—from glass to air, for example—the angle of refraction predicted by snell's law can be 90°...

More questions: History Another questions

Questions on the website: 13722360