History, 04.07.2019 06:10 Nerdylearner8639

Who praised for the greeks preparing the government of their new nation "a study of the fine models of science left by their ancestors, to whom we also are all indebted for the lights which originally led ourselves out of gothic darkness"?

Answers: 1

Show answers

Another question on History

History, 21.06.2019 21:00

What was the government purpose for creating “day schools”

Answers: 2

Answer

History, 21.06.2019 21:30

In order to get a consensus between anti-federalists and federalist to be able to forward on the constitution, james madison advocated for a bill of rights. what was the purpose of the bill of rights for citizens of the united states?

Answers: 3

Answer

History, 21.06.2019 22:30

Why did the other allies like great britain and france not support wilsons 14 points?

Answers: 3

Answer

History, 22.06.2019 00:00

Nazis who forced jews to live in ghettos also forced them to

Answers: 1

Answer

You know the right answer?

Who praised for the greeks preparing the government of their new nation "a study of the fine models...

Questions

Chemistry, 21.01.2021 22:30

The absorption of infrared radiation by clouds, water vapor, carbon dioxide, and other atmospheric gases is called: g...

Business, 21.01.2021 22:30

Discuss why making changes such as Mitsubishi did is important both legally and for improving HR management with the employees and managers....

English, 21.01.2021 22:30

How does Sawides' Lego explanation help explain how...

History, 21.01.2021 22:30

HELP FAST!! On this it’s a test ...

English, 21.01.2021 22:30

Read this sentence from the speech. But different men often see the same subject in different lights; and, therefore, I hope it will not be thought d...

Mathematics, 21.01.2021 22:30

Kristina walked 1 2/3 miles on Sunday and 2 3/4 miles on Monday. What was the total distance, in miles, that she walked over those two days...

Biology, 21.01.2021 22:30

Which statement best describes the interdependence of photosynthesis and cellular respiration? A. The reactants of photosynthesis are sugar and oxyge...

Computers and Technology, 21.01.2021 22:30

Write a simple program where you create an array of single byte characters. Make the array 100 bytes long. In C this would be an array of char. Use po...

Mathematics, 21.01.2021 22:30

A person in a boat floating in a small pond throws an anchor overboard. What happens to the level of the pond...

Mathematics, 21.01.2021 22:30

jogs every three days andjogs every four days. if today is a wednesday and and both jog today, in how many days will they both jog again on the same d...

Computers and Technology, 21.01.2021 22:30

Match the appropriate words to complete the paragraph. Wireless networks have no clear boundaries, therefore securing communications requires strong (...

Chemistry, 21.01.2021 22:30

a solution of dextrose contains 25.0 g solute in 250.0 g water. how should the percentage by mass of dextrose in this solution be calculated...

Chemistry, 21.01.2021 22:30

Green plants absorb sunlight to power photosynthesis, the chemical synthesis of food from water and carbon dioxide. The compound responsible for light...

History, 21.01.2021 22:30

WHY IS DRAKE SO FRGGIN COOOLIO ??? LIKE I LOVE HIM HAHAHAH ANYWAYS I NEED HELP ANS FRIEDNDSS HAHAHAHA...

Biology, 21.01.2021 22:30

Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?b) What is the mRNA compliment to the...

English, 21.01.2021 22:30

Part B: Which quotation from heart of darkness best supports that answer to part A...

Business, 21.01.2021 22:30

At the end of 2017, Stacky Corp. had $500,000 in liabilities and a debt-to-assets ratio of 0.5. For 2017, Stacky had an asset turnover of 3.0. What we...

Mathematics, 21.01.2021 22:30

A2+7b+3a+4 what statements can best describe this expression...

History, 21.01.2021 22:30

Where did the Europeans have more of a presence & influence around 1500? a. Americas b. Antarctica c. Asia d. Australia...

Mathematics, 21.01.2021 22:30

The pie chart shows the favorite retail clothing store of a group of teenagers. About what percentage of teenagers prefer ForLess? v%

More questions: History Another questions