Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

its been noted for the past decade or so that there is some (approximately 5% to 7%) shrinkage in the brains of people who have schizophrenia, most notably in the gray matter, which is an important part structures in the brain’s amygdala, hippocampus and parahippocampus, which are all involved in memory storage and retrieval memory storage and retrieval.

explanation:

ive read articles