subject
Health, 15.04.2020 23:10 MikaB1063

Why are whole grains more nutritious than refined grains?
Whole grains naturally contain nutrients and fiber,
B. Whole grains contain endosperm,
C. Whole grains do not contain bran,
D. Whole grains have nutrients added during processing

ansver
Answers: 2
Show answers

Another question on Health

question
Health, 21.06.2019 22:10
Why do we learn how to calculate the distance of a parabola in 10th grade but not what a 401k is?
Answers: 1
Answer
question
Health, 22.06.2019 12:00
Ireally need to know this answer asap
Answers: 1
Answer
question
Health, 22.06.2019 15:00
Larry is taking a walk in the park, the pollen in the air makes him sneeze consistently what line of defense is his immune system exhibiting
Answers: 1
Answer
question
Health, 22.06.2019 20:30
What is one limitation of the myplate guidelines
Answers: 1
Answer
You know the right answer?
Why are whole grains more nutritious than refined grains?
Whole grains naturally contain nutri...
Questions
question
Mathematics, 11.12.2019 18:31
Which of the following is not a step in finding the interest from a simple interest table? a. divide the principal by $100 to find the number o...
question
Chemistry, 11.12.2019 18:31
Can you find the quotient of 1/4 of 3...
question
Spanish, 11.12.2019 18:31
Select the word from the list that best fits the definition viene del mar....
question
Mathematics, 11.12.2019 18:31
The population parameters below describe the full-time equivalent number of students (ftes) each year at lake tahoe community college from 1976–1977 t...
question
Law, 11.12.2019 18:31
Researchers who study the causes of crime are called?...
question
Mathematics, 11.12.2019 18:31
Suppose a 95% confidence interval for the average amount of weight loss on a diet program for males is between 13.0 and 18.0 pounds. these results wer...
question
Business, 11.12.2019 18:31
Zhao co. has fixed costs of $255,000. its single product sells for $157 per unit, and variable costs are $107 per unit. the company expects sales of 1...
question
Chemistry, 11.12.2019 18:31
What is the concentration of a solution of hcl in which a 10.0 ml sample of acid required 50.0 ml of 0.150 m naoh for neutralization? what is the con...
question
Biology, 11.12.2019 18:31
Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the sequence taatacgactcactataggg has a melting temperature...
question
Business, 11.12.2019 18:31
Vesting refers to; a. how long until an employee owns any employer contributions to the employee's pension plan. b. how long until an e...
question
Chemistry, 11.12.2019 18:31
For which of the following will the entropy of the system increase? a. condensation of steam b. reaction of magnesium with oxygen to for...
question
Chemistry, 11.12.2019 18:31
What is wrong with the following mechanism? h2o 2) br br there is no leaving group, so there should be no arrows. a. b. the arrow should be removing...
question
Mathematics, 11.12.2019 18:31
When light passes from a more-dense to a less-dense medium—from glass to air, for example—the angle of refraction predicted by snell's law can be 90°...
question
Physics, 11.12.2019 18:31
When a hammer thrower releases her ball, she is aiming to maximize the distance from the starting ring. assume she releases the ball at an angle of 31...
question
Mathematics, 11.12.2019 18:31
What is the main difference between the explanation for the effect size for a one-way between-subjects anova and the one-way repeated measures anova?...
question
History, 11.12.2019 18:31
Many changes that have happened in american history started with one person standing up for what they believed in and others joining them in their cau...
question
Business, 11.12.2019 18:31
Abeekeeper lives adjacent to an apple orchard. the orchard owner benefits from the bees because each hive pollinates about one acre of apple trees. th...
question
Business, 11.12.2019 18:31
When evaluating the performance of rick, a buyer for the men’s clothing department, believing that rick is often late because his children are sick b...
question
Chemistry, 11.12.2019 18:31
Abottle of vintage red wine has lost its label. the concentration of a radioactive isotope of hydrogen (hydrogen-3 or tritium) in the wine is 0.34 tim...
question
Business, 11.12.2019 18:31
Abrilliant young scientist is killed in a plane crash. it is anticipated that he could have earned $330,000 a year for the next 50 years. the attorney...
More questions: Health Another questions
Questions on the website: 13722360
See results (0)