German, 28.07.2019 14:00 sebby33

What ending do possessive pronouns get when they refer to a feminine noun? no ending -e -es -ie

Answers: 1

Show answers

Another question on German

German, 25.06.2019 22:30

What is the circumference of the longitude of a unique shape to the 45th power logged? 45 45

Answers: 2

Answer

German, 03.07.2019 12:30

How to say "hello my name " in german?

Answers: 2

Answer

German, 04.07.2019 02:30

What's the easiest way to draw the symbol 'ß'? i always have issues with it and it doesn't look the way i like. , ?

Answers: 2

Answer

German, 05.07.2019 06:00

What is "ferry"? brainliest if correct

Answers: 2

Answer

You know the right answer?

What ending do possessive pronouns get when they refer to a feminine noun? no ending -e -es -ie...

Questions

Mathematics, 22.05.2020 07:57

Using the information from question 15, what was the unit price (price per card) for the 24 pack? Write your answer AS A DECIMAL WITHOUT A UNIT. * The...

Mathematics, 22.05.2020 07:57

What is the area of the figure below...

History, 22.05.2020 07:57

PLEASE HELP U. S. embassies are located in foreign countries, just like foreign countries have embassies in the United States. Why can’t governm...

Physics, 22.05.2020 07:57

An airplane is cruising along at a constant velocity of 245m/s East. Amazing Austin is on this airplane and wants to build a roller coaster out of the...

Advanced Placement (AP), 22.05.2020 07:57

Ocean water is sinking. What happens when water of a high density sinks?...

Social Studies, 22.05.2020 07:57

Carefully study the map above. Which of the following cities is most likely to have a maquiladora?A.El PasoB.

Mathematics, 22.05.2020 07:57

F(x) = x2. What is g(x)?...

Social Studies, 22.05.2020 07:57

ASAP 1. Describe and give an example of each of the following terms: civil law, criminal law, misdemeanor, felony. Type your answer here....

Biology, 22.05.2020 07:57

Do synthetic hormones, as in those used in birth control pills, don't affect the body and do the same thing as the natural hormone?...

English, 22.05.2020 07:57

Choose the Rhetorical Strategy that is described: When an author/speaker repeats a word or phrase to create emphasis *...

Social Studies, 22.05.2020 07:57

Which number BEST represents the Yellow Sea?...

Health, 22.05.2020 07:57

As Ms. Carlson returned the student papers she had graded, she was thinking about the fact that she had forgotten to pick up her dry cleaning on...

English, 22.05.2020 07:57

Dexters chicken would have been far more if he had just been able to from seasoning it with so much salt...

Business, 22.05.2020 07:57

Opportunity cost is best described by which of the following statements? Choose 1 Choose 1 (Choice A) The value...

Mathematics, 22.05.2020 07:57

Two sides of a triagle have a lengths 15cm and 19 cm. which measurement can be the length of the third side?...

English, 22.05.2020 07:58

What is Daisy's response to Gatsby's wealth?...

Chemistry, 22.05.2020 07:58

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please...

Geography, 22.05.2020 07:58

What are the crops grown in Greece are found on farmland A) on grabbed in southern Greece B)on more than 2,000islands ...

Biology, 22.05.2020 07:58

What is a cell cycle?...

Biology, 22.05.2020 07:58

Which adaptation pervents the darker moth from being visible to birds...

More questions: German Another questions