subject
Biology, 07.01.2021 04:50 vic2nvsty

Nitrogen from animal wastes or plant an animal tissue O must be fixed near leguminous plants,
O is lost from the system.
O is fixed by bacteria and fungi in the soil.
O is already fixed and can be used.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 11:00
Which statement correctly describes other ways in which nebulae and stars are different? a. a star always has a higher density than a nebula. b. stars can form inside a nebula but a nebula can never be produced by any star. c. stars can never form inside a nebula but a nebula can be produced by any star. d. a nebula always has a higher density than a star. reset submit
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:00
Compare and contrast your sells take in oxygen, water, and food. what is one waste product that leaves your cells?
Answers: 1
question
Biology, 22.06.2019 14:10
Select the correct answer.what is the observable characteristic of a person called? o a. genotypephenotypeoc.alleleo d.gene
Answers: 2
You know the right answer?
Nitrogen from animal wastes or plant an animal tissue O must be fixed near leguminous plants,
...
Questions
question
Mathematics, 05.05.2020 04:44
question
Advanced Placement (AP), 05.05.2020 04:45
question
Health, 05.05.2020 04:45
Questions on the website: 13722367