subject
Biology, 20.10.2020 03:01 Cayden7950

3. You are a Gold merchant. Someone brought in a bar of Gold (Au). The Gold measured 15.5cm in length, 22.3cm in width, and 10.1cm in height. When you found its displacement, the initial volume was 1100mL and the finale volume was 4400mL. What was the Gold bar's most precise measurement of its volume? (show your work)

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 04:20
Hybrid instruments that play sounds that are part sampled and part synthesized are known as:
Answers: 1
question
Biology, 22.06.2019 05:30
Where can dna be found in a prokaryotic cell
Answers: 2
question
Biology, 22.06.2019 09:00
The current thought on the structure of the cell membrane is: a. a static phosphate sandwich of lipids b. a fluid-mosaic of phospholipids and proteins c. a bilayer of proteins with static lipid molecules d. an impermeable bilayer of protein molecules e. a static and permeable phospholipid single layer
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
3. You are a Gold merchant. Someone brought in a bar of Gold (Au). The Gold measured 15.5cm in lengt...
Questions
question
English, 09.04.2021 04:50
question
Mathematics, 09.04.2021 04:50
question
Mathematics, 09.04.2021 05:00
question
Chemistry, 09.04.2021 05:00
Questions on the website: 13722360