subject
Biology, 10.09.2020 03:01 jessiebotello7209

For hundreds of years, people believed that life forms could just appear. That is because they could not see microscopic organisms. In 1859, Louis Pasteur performed an important experiment that proved there were small, unseen bacteria in the air that caused milk to sour and food to rot. He later linked that to unseen organisms that also cause disease. To which part of the Cell Theory did Pasteur make the biggest contribution? Q: A: A) Cells are the basic units of life. B) All organisms are composed of cells. C) All cells come from pre-existing cells. Eliminate D) Cells contain DNA which is found specifically in the chromosome and RNA found in the cell nucleus and cytoplasm.

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 17:30
How will technology impact medicine in the future?
Answers: 1
question
Biology, 21.06.2019 22:00
What happens when the cell copies its chromosomes
Answers: 2
question
Biology, 22.06.2019 06:00
Set comes up with for examples of sound waves ocean wave light wave and hand wave which of tonys examples is not an actual scientific wave
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
For hundreds of years, people believed that life forms could just appear. That is because they could...
Questions
question
Mathematics, 04.05.2021 19:10
question
Mathematics, 04.05.2021 19:10
question
Mathematics, 04.05.2021 19:10
question
Mathematics, 04.05.2021 19:10
question
Mathematics, 04.05.2021 19:10
Questions on the website: 13722367