subject
Biology, 26.08.2020 23:01 deedoe2679

What happens to an egg that is not fertilized? It is reabsorbed by the body. It travels back up the fallopian tube. It exits during childbirth. It is released during menstruation.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 07:00
Explain how sequences of amino acids in proteins can be used to reveal relationships among organisms.
Answers: 2
question
Biology, 22.06.2019 09:10
Hormones are chemical molecules produced by endocrine glands. one such endocrine gland is the thyroid gland, which synthesizes the thyroid hormone, which in turn affects the heart muscles. which two statements describe the probable reason for the function of the hormone? the cells in the heart have specific receptors that allow for the intake of hormones. the heart and the endocrine glands have the exact same types of cells. all cells make the same types of hormones. thyroid hormones show their effect on the heart by means of specialized cells. thyroid cells and cardiac cells have different dna.
Answers: 1
question
Biology, 22.06.2019 11:30
Which of the following explains why a tree is often used as a model to represent the principle of common descent
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What happens to an egg that is not fertilized? It is reabsorbed by the body. It travels back up the...
Questions
question
Chemistry, 30.08.2019 18:20
Questions on the website: 13722362