Biology, 29.07.2020 14:01 Andinojose
The diagram below shows the first four steps of meiosis. What is happening
in the step labeled A?
Meiosis I
88
B
С
O A. Spindle fibers are moving the chromosomes to the center of the
cell.
O B. Mitotic spindles and spindle fibers are forming
O C. Spindle fibers are pulling the tetrads apart.
O D. The chromosomes are copied and form tetrads.
Answers: 1
Biology, 21.06.2019 22:00
Which statement best describes the relationship between an allele and a gene? question 1 options: an allele is a variation of a gene that can be expressed as a phenotype. an allele is the part of a gene that attaches to messenger rna molecules. an allele is a segment of a dna molecule that controls replication of a gene.
Answers: 3
Biology, 22.06.2019 06:10
Long-period comets come from the oort cloud particles in earth’s atmosphere material from the asteroid belt the kuiper belt
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The diagram below shows the first four steps of meiosis. What is happening
in the step labeled A?
English, 02.07.2019 19:20