Vhat happens to forests and overall biodiversity as the consumption of orests increases?
O A. The total supply of forests and biodiversity both increase.
B. The total supply of forests and biodiversity both decrease.
O C. The total supply of forests decreases, and biodiversity increases.
D. The total supply of forests increases, and biodiversity decreases.
SUBMIT

Iwanna go do something with my ideas? ?

Which of the following describes how binary fission and mitosis are similar? a)they are both used for growth or repair b)they both break down membrane-bound nuclei c)both invoke the replication of a single stand of dna d)both replicate genetic material

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?