subject

Biology, 05.05.2020 10:24 donterriuscollier

Explain how CRISPR could be used to cure a genetic disorder like DMD.

ansver

Answers: 1

Show answers

Another question on Biology

question

Biology, 22.06.2019 09:00

Which statement describes characteristics of planarians? a they live in oceans, are parasites, and reproduce only sexually. b they live in fresh water, are parasites, and reproduce only asexually. c they live in oceans, are free living, and reproduce sexually and asexually. d they live in fresh water, are free living, and reproduce sexually and asexually.

Answers: 3

question

Biology, 22.06.2019 12:00

The embryos of a bird, a reptile, and a mammal are similar in appearance. how does comparing the physical appearance of embryos of different species support the theory of evolution? a. it shows that these organisms share a common ancestor. b. it provides evidence that these organisms eat the same foods.c. it shows that these organisms share the same habitat.d. it provides evidence that these organisms suffered a genetic mutation.

Answers: 1

question

Biology, 22.06.2019 13:30

How and why organisms are hierarchically classifies

Answers: 3

question

Biology, 22.06.2019 16:30

Aplant with dark red flowers is crossed with a plant with white flowers. all of the offspring have dark red flowers with white spots. the alleles got flower color in this plant are both dominant both recessive codominant incompletely dominant

Answers: 1

You know the right answer?

Explain how CRISPR could be used to cure a genetic disorder like DMD....

Questions

question

Social Studies, 10.03.2020 08:08

Many different approaches have been suggested to aid the analyst in identifying a set of candidate objects for the structural model. The four most com...

question

Business, 10.03.2020 08:08

An angry customer has emailed Kurtis wanting to know why the custom luggage he ordered three weeks ago hasn't arrived yet. When Kurtis looks up the or...

question

Biology, 10.03.2020 08:08

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperatur...

question

Business, 10.03.2020 08:08

You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The bet...

question

Mathematics, 10.03.2020 08:08

Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer lab...

question

Business, 10.03.2020 08:08

River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assum...

question

Social Studies, 10.03.2020 08:08

Assume that the union wage already exceeds the market-clearing wage. If the union wage is increased, holding other factors constant, then the number u...

question

Business, 10.03.2020 08:08

In which type of operations are you likely to see, at most, only minor variations in the product or service being produced using the same process and...

question

Business, 10.03.2020 08:08

The purpose of is to conceive, analyze, and creatively select channels of communication that will direct advertising messages to the right people in...

question

Physics, 10.03.2020 08:08

In terms of impulse and conservation of momentum, explain why a glass is much more likely to break if it falls onto a cement floor than if it falls on...

question

Business, 10.03.2020 08:08

Unlike manufacturers, buy products from other businesses but do not significantly alter the form of the products they buy before selling them....

question

Biology, 10.03.2020 08:09

C. Which specific biomolecule (lipid, protein, nucleic acid, carbohydrate) is each food mostly made of?...

question

Physics, 10.03.2020 08:10

A mass that weighs 8 lb stretches a spring 6 in. The system is acted on by an external force of 8 sin(8t) lb. If the mass is pulled down 3 in and then...

question

Mathematics, 10.03.2020 08:10

Which best describes how an accretionary wedge forms? Group of answer choices as a result of the accumulation of sediment and oceanic crust being scra...

question

Mathematics, 10.03.2020 08:10

You toss independently a fair coin and you count the number of tosses until the first tail appears. If this number is n, you receive 2n dollars. What...

question

Mathematics, 10.03.2020 08:10

In the xyxyx, y-plane above, the circle has center (h, k)(h, k)(, h, comma, k, )and radius 101010. What is the value of kkk ?...

question

Business, 10.03.2020 08:10

Chuck believes that his business has grown because of his personal involvement in every step of the way. What advice do you offer Chuck as he continue...

question

Mathematics, 10.03.2020 08:10

Exercise 1. Assume f : [a, b] ! R is integrable. (a) Show that if g satisfies g(x) = f(x) for all but a finite number of points in [a, b], then g is i...

question

Business, 10.03.2020 08:10

The following refers to units processed by a breakfast cereal maker in August. Compute the total equivalent units of production with respect to conver...

question

Physics, 10.03.2020 08:10

Find the dimensions of the rectangular box with largest volume if the total surface area is given as 100 cm2. (Let x, y, and z be the dimensions of th...

More questions: Biology Another questions

Questions on the website: 13722361