subject

Mathematics, 20.08.2019 05:00 jamaiciaw6

You clean a community park for 6.5 hours. you earn $42.25. how much do you earn per hour?

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 15:00

Which value of c would make he following expression completely factored? 8x+cy

Answers: 1

question

Mathematics, 21.06.2019 19:20

Which of the following quartic functions has x = –1 and x = –2 as its only two real zeroes?

Answers: 1

question

Mathematics, 21.06.2019 19:30

Which of the following is the explicit rule for a geometric sequence defined a recursive formula of a -5a for which the first term is 23?

Answers: 1

question

Mathematics, 21.06.2019 19:40

Graph y = -|x| + 2. click on the graph until the correct one appears.

Answers: 3

You know the right answer?

You clean a community park for 6.5 hours. you earn $42.25. how much do you earn per hour?...

Questions

question

English, 01.04.2021 17:30

Which sentence best explains Lincoln's wartime decisions? BRANLIEST adapted from Lincoln the Great by Wilfred W. McClay We should r...

question

English, 01.04.2021 17:30

What Is the parallel structure and how do I find it?...

question

Business, 01.04.2021 17:30

The manufacturing overhead budget at Foshay Corporation is based on budgeted direct labor-hours. The direct labor budget indicates that 7,800 direct l...

question

English, 01.04.2021 17:30

For a company to develop an effective customer-centric culture, there is always room for:...

question

Mathematics, 01.04.2021 17:30

This math problem help me...

question

Biology, 01.04.2021 17:30

What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...

question

Chemistry, 01.04.2021 17:30

Which of the following statements are true regarding the remainder of the experiment if the scientist wants to use the combined gas law to calculate d...

question

Biology, 01.04.2021 17:30

Which scenario MOST LIKELY represents genetic drift and why? Question 2 options: Scenario 2, because the dark beetles are most fit for th...

question

Mathematics, 01.04.2021 17:30

Please help Lia brought 21 shirts and plants. Her total was $357. Pants cost $25 each, and shirts cost $14.50 each. How many of each item did she buy?...

question

Business, 01.04.2021 17:30

The McAllisters had several serious problems with their house, including leaks in the ceiling, a buckling wall, and dampness. They repaired the buckli...

question

Business, 01.04.2021 17:30

The goal of the review in a business presentation is to Multiple choice question. compel audience members to consider taking specific actions. lead au...

question

History, 01.04.2021 17:30

"If a thousand [citizens] were not to pay their tax-bills this year, that would not be a violent and bloody measure, as it would be to pay them, and e...

question

History, 01.04.2021 17:30

Which TWO of the following is a task carried out by the executive branch? Select two answers....

question

Mathematics, 01.04.2021 17:30

Solve for x please help ...

question

History, 01.04.2021 17:30

Do you think something like the Red Scare could happen again?...

question

Mathematics, 01.04.2021 17:30

Which is equivalent to (–9n + 12)?...

question

English, 01.04.2021 17:30

Okay who wants to prank call my school? well the # is (616) 538-7670 call and say hey can i order a medium deep dish pizza with extra cheese an...

question

Mathematics, 01.04.2021 17:30

Which angles are adjacent to each other? Select all that apply.

question

Mathematics, 01.04.2021 17:30

Find a mobius transformation T that takes the real axis to the unit circle and then evaluate the resulting integral....

question

History, 01.04.2021 17:30

Why did discrimination and racism toward Asian Americans (specifically Japanese-Americans) exist before the Pearl Harbor attack?...

More questions: Mathematics Another questions

Questions on the website: 13722366