subject
Mathematics, 25.12.2021 09:00 metatiley

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

ansver
Answers: 1

Another question on Mathematics

question
Mathematics, 21.06.2019 16:40
You have 3 boxes, one "strawberries"; one "mentos" and one "mixed".but you know that all the labels are in incorrect order .how do you know witch is witch?
Answers: 1
question
Mathematics, 21.06.2019 19:30
Agroup of randomly selected apple valley high school students were asked to pick their favorite gym class. the table below shows the results of the survey. there are 528 students at apple valley high school. gym class number of students racquet sports 1 team sports 9 track and field 17 bowling 13 based on the data, what is the most reasonable estimate for the number of students at apple valley high school whose favorite gym class is bowling? choose 1 answer a. 9 b. 13 c. 119 d. 172
Answers: 1
question
Mathematics, 21.06.2019 22:00
If abcde is reflected over the x-axis and then translated 3 units left, what are the new coordinates d?
Answers: 3
question
Mathematics, 22.06.2019 00:20
Last week , donnell practiced the piano 3 hours longer than marcus . together, marcus and donnell practiced the piano 11 hours . for how many hours did each young man practiced the piano
Answers: 3
You know the right answer?
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type...
Questions
question
World Languages, 29.11.2019 02:31
Questions on the website: 13722363