Mathematics, 19.05.2021 19:30 bre644

Alex runs 35 meters across a rectangular park on a diagonal path, length
28 m
Park
width = x
35 m
Enter the park width, in meters, if the length of the park is 28 meters.

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:00

Which graph corresponds to the function f(x) = x2 + 4x – 1?

Answers: 1

Answer

Mathematics, 21.06.2019 17:30

Graph the equation. select integers for x

Answers: 1

Answer

Mathematics, 21.06.2019 21:00

Reagan lives five miles farther from school than vanessa lives. write an expression to describe how far reagan lives from school

Answers: 1

Answer

Mathematics, 21.06.2019 21:00

Joanie watched 1 out of three of a movie in the morning

Answers: 1

Answer

You know the right answer?

Alex runs 35 meters across a rectangular park on a diagonal path, length
28 m
Park

Questions

History, 05.05.2020 09:24

Which law required certain people to enlist in the military...

Mathematics, 05.05.2020 09:24

Choose the isosceles triangles....

Biology, 05.05.2020 09:24

A bicyclist is riding north at a speed of 15 kilometers per hour (km/h). The wind is blowing toward the north at 10 km/h. What is the bicyclist'...

Social Studies, 05.05.2020 09:24

Which one of the following characteristics is not necessarily true about groups? A. Group members are interdependent. B. Groups are dete...

Biology, 05.05.2020 09:24

Consider two mailbox that are shown below which of Charles Darwin’s main points is depicted in the image...

Biology, 05.05.2020 09:24

What is the best definition for the underlined word based on the following sentences dedicated artist focus on every aspect of a song to make it perfe...

Mathematics, 05.05.2020 09:24

Solve the following equation and check your results ?4z+3=6+2z8x+4=3(x-1)+72x-1=14-x2y+5/3=26/3-y

Mathematics, 05.05.2020 09:24

Francis analyzes the given data sets. Data Set A: 20,25,28,30,39,40 Data Set B: 20,22,23,27,30,42 Which correct Statement can Franci...

English, 05.05.2020 09:24

Which example shows the strongest conclusion? Diversity clubs benefit schools in many different ways. They make schools safer, promote student l...

Mathematics, 05.05.2020 09:24

17x - 400 = 250 + 30x...

Mathematics, 05.05.2020 09:24

Need some help just can’t understand...

English, 05.05.2020 09:24

Who is narrator to the book Fly Girl and how can you describe the narrator?...

Chemistry, 05.05.2020 09:24

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message...

Chemistry, 05.05.2020 09:24

Which of the following is a way in which elements and compounds are similar? Elements and compounds are listed on the periodic table.

Mathematics, 05.05.2020 09:24

Lisa and Elise are discussing measures of spread. Elise says the best measure of spread with which to compare data sets is the IQR. Lisa says th...

History, 05.05.2020 09:24

PlZ HELP ASAP PlZ PLZ 100 POINTS BRAINLIEST PLZ PLZ ASAP The Mayflower Compact established Choose 1 Choose 1 (C...

Mathematics, 05.05.2020 09:24

Madison and Tyler each wrote an expression that is equivalent to 14.1(19.8+7.6)The expressions they created are shown in the table...

Mathematics, 05.05.2020 09:24

If Ahn select a card at random, what is the probability that she is Alexa card with a tree on it, replaces it, and then select a card with a dog on it...

English, 05.05.2020 09:24

The author’s main claim is that a diet rich in vegetables, whole grains, and beans can help prevent cancer. Which sentence from the passag...

Mathematics, 05.05.2020 09:24

Given that a triangle LMN has side inches of 18.5 inches, 10, inches, and 15.5 inches, prove triangle LMN is aright triangle....

More questions: Mathematics Another questions

Alex runs 35 meters across a rectangular park on a diagonal path, length 28 m Park width = x 35 m Enter the park width, in meters, if the length of the park is 28 meters.

Answers

Another question on Mathematics

Alex runs 35 meters across a rectangular park on a diagonal path, length
28 m
Park
width = x
35 m
Enter the park width, in meters, if the length of the park is 28 meters.