subject

Mathematics, 01.05.2021 06:20 edandjill24

PLEASE HELP
Dilate the point (-6,3) by a scale factor of 1/3 from the origin

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 17:00

The following graph shows the consumer price index (cpi) for a fictional country from 1970 to 1980? a.) 1976 - 1978b.) 1972 - 1974c.) 1974 - 1976d.) 1978 - 1980

Answers: 1

question

Mathematics, 21.06.2019 19:00

What is the percentile for data value 6 in the following data set? 4 13 8 6 4 4 13 6 4 13 2 13 15 5 9 4 12 8 6 13 40 25 35 62

Answers: 2

question

Mathematics, 22.06.2019 02:00

Will make ! for correct answer the dot plot below shows the number of toys 21 shops sold in an hour.is the median or the mean a better center for this data and why? a. median; because the data is not symmetric and there are outliersb. median; because the data is symmetric and there are no outliersc. mean; because the data is symmetric and there are no outliersd. mean; because the data is skewed and there are outliers

Answers: 2

question

Mathematics, 22.06.2019 02:30

The floor of a building consists of 3000 tiles which are rhombus shaped and each of it's diagonals are 45 cm and 30 cm in length. find the total cost of polishing the floor, if the cost per m² is rs. 4.

Answers: 1

You know the right answer?

PLEASE HELP
Dilate the point (-6,3) by a scale factor of 1/3 from the origin...

Questions

question

Mathematics, 24.02.2021 17:50

In which choice are all four points on the same straight line

question

Mathematics, 24.02.2021 17:50

The table below shows the total sales by a computer salesman during a three-year period. year 1. $5,000. year 2. $8,500 year 3. $10,500 If the salesm...

question

History, 24.02.2021 17:50

The discovery of the clay bricks at Ur was important because the bricks showed people had lived there as the Bible said. TrueFalse...

question

Biology, 24.02.2021 17:50

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...

question

Mathematics, 24.02.2021 17:50

if the skating rink was $6 per person and the birthday party will cost $72, how many skaters will be at sami's party?...

question

Social Studies, 24.02.2021 17:50

What can be good for the colonized?...

question

Biology, 24.02.2021 17:50

Which of these is a primary food crop...

question

Mathematics, 24.02.2021 17:50

Georgie had her roof repaired and She was charged an extra 2.5% for late payment. She had to pay a total of £977.85. Calculate how much she would have...

question

Physics, 24.02.2021 17:50

if the radii of two circles with centre o and o' are 7cm and 10cm and the distance between their centres is 12cm in how many points do the circle inte...

question

Mathematics, 24.02.2021 17:50

I need help please ...

question

Mathematics, 24.02.2021 17:50

5 over 12 hour = ___ minutes...

question

Mathematics, 24.02.2021 17:50

What’s the answer? Please ...

question

Mathematics, 24.02.2021 17:50

Help! Need by 10:30 to turn in and I'm confused! When Anthony contracted the flu, he needed tissues and cough drops. Each box of tissues cost $1.69 a...

question

Mathematics, 24.02.2021 17:50

Which of following is the graph of y = -(x + 1)- -3?...

question

Mathematics, 24.02.2021 17:50

Please help .Given the assignment categories and weights listed below, what overall grade should the student get in the class? Round your answer to o...

question

SAT, 24.02.2021 17:50

Raymond's weekly income consists of a base salary for a 40-hour workweek plus overtime pay. 'l'he overtime pay is paid at an hourly rate for th...

question

English, 24.02.2021 17:50

Why is life messed up...

question

History, 24.02.2021 17:50

3) list 2 things Mussolini's conquest in Africa proved regarding the League of nations, England and France? ASAP...

question

Mathematics, 24.02.2021 17:50

In the fruit bowl the ratio of apples, bananas, and pears is 4.2, 5. If the total fruit is 55 how many of each fruit are in the bowl. *...

question

Mathematics, 24.02.2021 17:50

WILL GIVE BRAINLIEST! Use the roster method to write the set. The positive integers less than 7...

More questions: Mathematics Another questions

Questions on the website: 13722362