subject

Mathematics, 12.04.2021 01:00 Ididntwanttomakethis

HELP! What is the greatest common factor of 20a2b2 and 50b3?

HELP! What is the greatest common factor of 20a2b2 and 50b3?

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 17:30

What is the 12th term of b(n)=-4-2(n-1)

Answers: 1

question

Mathematics, 21.06.2019 18:00

Carmen begins her next painting on a rectangular canvas that is 82.7 cm long and has a area of 8,137.68 cm2. will the painting fit in a frame with an opening that is 82.7 cm long and 95 cm wide? explain

Answers: 3

question

Mathematics, 21.06.2019 18:50

In which form is the following function written? y = - 2(x – 3)(x + 5)

Answers: 1

question

Mathematics, 21.06.2019 19:30

Geometry in the diagram, ∠abc is a right angle. ∠dbc = 30°27'40". find the measure of ∠abd.

Answers: 1

You know the right answer?

HELP! What is the greatest common factor of 20a2b2 and 50b3?
...

Questions

question

Business, 15.04.2020 03:53

Identify the items as consumer programs or consumer information sources local chambers of commerce consumer reports state cons...

question

English, 15.04.2020 03:53

Kite Runner Quiz Chapters 1-5 1. The novel begins with a flashback. What do you think is its purpose? What do you learn about the narrator? 2. Who is...

question

Computers and Technology, 15.04.2020 03:53

Which of the following is not a true statement? a. Data flow diagrams and flowcharts are difficult to prepare and revise using software packages. b. D...

question

Business, 15.04.2020 03:53

Consider the equation %ΔM + %ΔV ≈ %ΔP + %ΔY. If the velocity of money does not change (%ΔV = 0), and the change in real GDP exactly keeps pace with th...

question

English, 15.04.2020 03:53

The main idea is usually found after the topic sentence. True False...

question

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

question

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...

question

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...

question

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

question

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

question

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

question

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

question

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

question

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...

question

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

question

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...

question

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...

question

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...

question

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...

question

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...

More questions: Mathematics Another questions

Questions on the website: 13722367