Mathematics, 01.04.2021 19:00 jetblackcap

A stack of 250 pieces of paper is 1.875 in tall. Diego guess is that each piece of paper is 0.075 inches thick. Explain how you know that Diego answer is incorrect. Compute the thickness of each piece of paper. Show you reasoning.

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:00

Which set of reflections would carry trapezoid abcd onto itself? a) x-axis, y=x, y-axis, x-axis b) x-axis, y-axis, x-axis c) y=x, x-axis, x-axis d) y-axis, x-axis, y-axis, x-axis

Answers: 2

Answer

Mathematics, 21.06.2019 17:50

For f(x)=2x+3 and g(x)=x^2- 8 find (f+g) (x)

Answers: 1

Answer

Mathematics, 21.06.2019 18:30

Consider the function f(x)=-5x+3 what is f(-2)

Answers: 2

Answer

Mathematics, 21.06.2019 20:00

Which type of graph would allow us to compare the median number of teeth for mammals and reptiles easily

Answers: 2

Answer

You know the right answer?

A stack of 250 pieces of paper is 1.875 in tall. Diego guess is that each piece of paper is 0.075 in...

Questions

Mathematics, 04.04.2020 13:59

PLEASE!! Dinah invests $850 in a high-yield savings account. The account pays 3% simple interest annually. Is it reasonable that Dinah wil...

Biology, 04.04.2020 13:59

Which steps are part of the process during the formation of molded fossils? Check all that apply. Sediment hardens into rock. Sedime...

Mathematics, 04.04.2020 13:59

PLEASE HELP WILL NAME BRAINLIEST...

Computers and Technology, 04.04.2020 14:00

Which of the following is true of data collection:. a. Data collection is of secondary importance to computer security. b. Data collection should not...

Physics, 04.04.2020 14:00

An air-plane has an effective wing surface area of 17.0 m² that is generating the lift force. In level flight the air speed over the top of the wings...

Biology, 04.04.2020 14:00

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along thi...

Chemistry, 04.04.2020 14:00

2.00 moles of an ideal gas was found to occupy a volume of 17.4L at a pressure of 3.00 atm and at a temperature of 45 C. Calulate the value of the cas...

Mathematics, 04.04.2020 14:00

A group of n people enter an elevator in a building with k floors. Each person independently selects a floor uniformly at random (each with equal prob...

Chemistry, 04.04.2020 14:01

What is likely to be true about the ∆H for this reaction? C6H6 (l) → C6H6 (s) ∆H>0 ∆H=0 ∆H<0...

Mathematics, 04.04.2020 14:01

Cole is studying employment trends.He found that 20% of the social workers he surveyed, or 45 social workers,work part time. How many soci...

Business, 04.04.2020 14:01

A 12-year bond of a firm in severe financial distress has a coupon rate of 12% and sells for $920. The firm is currently renegotiating the debt, and i...

Business, 04.04.2020 14:01

Magic Milling Company has 9% annual coupon bonds that are callable and have 18 years left until maturity. The bonds have a par value of $1,000, and th...

Mathematics, 04.04.2020 14:01

He assignment problem is . ANSWER Unselected a specialized form of an optimization model that attempts to assign limited capacity to various demand po...

Mathematics, 04.04.2020 14:01

Ashley picked up 15 rocks. 3 igneous, 3 metamorphic, and 9 sedimentary. What is the ratio of sedimentary rocks to the total number of rocks?...

Mathematics, 04.04.2020 14:01

Consider quadrilateral BCEF inscribed in circle A. Diagonals EB and CF intersect at point D. Select all the statements that are true about the diagram...

Business, 04.04.2020 14:01

Bay City uses the purchases method to account for supplies. At the beginning of the year the city had no supplies on hand. During the year the city pu...

Computers and Technology, 04.04.2020 14:01

All but one of the following statements about stored procedures is true. Which one is false? a. They consist of one or more SQL statements. b. They ar...

Business, 04.04.2020 14:01

In 2009 the federal excise tax on cigarettes was raised. In response, the CDC noted that "... because low-income groups are more responsive to price i...

Physics, 04.04.2020 14:02

Determina la magnitud de la fuerza que se debe aplicar a un sillón cuya masa es de 40 kg para que adquiera una aceleración con magnitud de 3 m/s²...

Business, 04.04.2020 14:02

Which of the following statements is false? Marginal cost will equal average total cost when average total cost is at its lowest point. When marginal...

More questions: Mathematics Another questions