Mathematics, 03.03.2021 01:00 raquelle66

Pls answer ASAP!! :)) Isabella is calculating the interest earned on a deposit of $3000 in an account that earns 4% simple interest after 6 years I=prt I= 3000(.04)(6). A. I=3,720. Isabella determines that her deposit will then be worth 6,720.00. Explain what Isabella did incorrect

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 16:00

What is the value of x in the diagram below?

Answers: 2

Answer

Mathematics, 21.06.2019 20:40

Reduce fractions expressing probability to lowest terms. in 3,000 repetitions of an experiment, a random event occurred in 500 cases. the expected probability of this event is?

Answers: 3

Answer

Mathematics, 21.06.2019 21:30

For the inequality |c| < |d| to be true, which of the following must be true?

Answers: 2

Answer

Mathematics, 21.06.2019 23:30

Consider the sequence below. 3 , 1 , 1/3 , 1/9 , select the explicit function which defines the sequence.

Answers: 1

Answer

You know the right answer?

Pls answer ASAP!! :)) Isabella is calculating the interest earned on a deposit of $3000 in an accoun...

Questions

Arts, 25.02.2021 09:10

Mixing consoles are now very sophisticated. Do sound engineers still need to use their techniques to replicate sounds for film and television? Questi...

English, 25.02.2021 09:10

In the story THE BLUE-EYED, BROWN-EYED EXERCISE What did the students most likely learn from the experiment?

History, 25.02.2021 09:10

Question 4 of 5 Which action is an example of domestic policy rather than foreign policy? A. Creating a new tax to pay for a health care progra...

History, 25.02.2021 09:10

- What is the number one killer of African children under the age of 5?...

English, 25.02.2021 09:10

(Fever 1793) The primary source excerpt above is taken from a manual outlining how young ladies should behave. How does More advise women to talk?...

Chemistry, 25.02.2021 09:20

9. Compare your calculated Ksp values with literature values. (Quote your source, indicating title, author, page, and edition). Briefly account for a...

Physics, 25.02.2021 09:20

The musical tone a piano has a frequency of 346HZ and a wavelength of 1.3 M what is the speed of the sound...

Biology, 25.02.2021 09:20

Transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC ...

Biology, 25.02.2021 09:20

What does the mnemonic device "Did King Philip Come Over For Good Spaghetti" mean, in terms of Taxonomy and Classification?...

Mathematics, 25.02.2021 09:20

If p is the length of perpendicular dropped from the origin on the line x/a+y/b=1 ,prove that 1/a^2+1/b^2=1/p^2...

World Languages, 25.02.2021 09:20

How to see that how many thanks i have got in??

Physics, 25.02.2021 09:20

A person is attracted toward the center of the earth by a 500N gravitational force. The force that the earth is attracted toward the person is -...

English, 25.02.2021 09:20

And if you rise above the noise and the pressures that surround you, if you stay true to who you are and wher you come from, if you have faith in God...

English, 25.02.2021 09:20

Please help me I will give brainliest ...

Mathematics, 25.02.2021 09:20

Russell is purchasing a $175,000 home with a 30-year mortgage. He will put down $15,000 down payment. Use the table below to find his monthly PMI

Mathematics, 25.02.2021 09:20

PLEASE HELP The tape diagram represents an equation. Write an equation to represent the tape diagram. Choose 1 A. 16=y...

Mathematics, 25.02.2021 09:20

The change in the population of fruit flies can be modeled by the equation P\left(t\right)=3\ \left(1.50\right)^t , where t is time in days. Which sta...

Mathematics, 25.02.2021 09:20

How do I solve this equation ...

English, 25.02.2021 09:20

What do you think Mattie thinks about the expectations of young girls to become well-bred women?...

Mathematics, 25.02.2021 09:20

А B 22+6 C Given: ABDC is a rectangle, m2ABC = 30° Find the measure e of y....

More questions: Mathematics Another questions