subject

Mathematics, 06.11.2020 19:10 thicklooney

Tanyas heart rate is65 beats per minute. If her heart beats 757521 times how much time has elapsed

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 15:00

Use the graph to determine the range. which notations accurately represent the range? check all that apply. (–∞, 2) u (2, ∞) (–∞, –2) u (–2, ∞) {y|y ∈ r, y ≠ –2} {y|y ∈ r, y ≠ 2} y < 2 or y > 2 y < –2 or y > –2

Answers: 1

question

Mathematics, 21.06.2019 18:00

Ihave trouble finding the nth term of a linear sequence

Answers: 2

question

Mathematics, 21.06.2019 22:10

Rationalize the denominator- 12x/√x-10

Answers: 1

question

Mathematics, 21.06.2019 23:30

Without multiplying, tell which product is larger and why. 5 × 1/3 or 5 × 2/3 a)5 × 1/3 because 1/3 is less than 2/3 b) 5 × 1/3 because 1/3 is greater than 2/3 c) 5 × 2/3 because 1/3 is less than 23 d) 5 × 23 because 1/3 is greater than 2/3

Answers: 1

You know the right answer?

Tanyas heart rate is65 beats per minute. If her heart beats 757521 times how much time has elapsed...

Questions

question

Mathematics, 04.07.2019 12:00

Find the inverse of the function h(x) = -2x+5...

question

French, 04.07.2019 12:00

How many children does the average family in luxembourg have? less than two three none four or more...

question

Mathematics, 04.07.2019 12:00

Idon’t no what this answer is -2(6x+5)=110...

question

Mathematics, 04.07.2019 12:00

There are 2140 beads in a set, if using beads that have 7 to make braceletshow many bracelets can be made...

question

Mathematics, 04.07.2019 12:00

On a math team at the beginning of the year, 3/5 of the kids are girls. the ratio of girls to boys is 3: 2. at the end of the year, 5 girls join the t...

question

Mathematics, 04.07.2019 12:00

What is the mean of this question i need the answer asap...

question

Mathematics, 04.07.2019 12:00

There are 745 students going on a school field trip. each bus can carry 46 students. how many buses should the school reserve? explain your reasoning...

question

Biology, 04.07.2019 12:00

5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for the template strand....

question

Mathematics, 04.07.2019 12:00

Polynomial with degree of 3 and zeros 2, -5, 0...

question

Mathematics, 04.07.2019 12:00

Samson uses 6 gallons of water on 20 plants in his garden. at that rate, how much water will it take to water 30 plants?...

question

Social Studies, 04.07.2019 12:00

Which country is labeled with the letter "c"? ...

question

Biology, 04.07.2019 12:00

What words are missing from the diagram 1.a, chlorophyll; b, water 2.a, nadph; b, sunlight 3. a, chlorophyll; b, atp 4. a, oxygen; b, atp

question

Mathematics, 04.07.2019 12:00

Solve the proportion 7.375meters. = xmeters. 1.475seconds. 1second show your work...

question

Biology, 04.07.2019 12:00

Language is dependent on what and it thus a product of the limbic system as well?...

question

Mathematics, 04.07.2019 12:00

Tatum wants to use partial products to find 15✖️32.write the numbers in the boxes to show 15✖️32...

question

Chemistry, 04.07.2019 12:00

How many valence electrons can atoms of non metals have?...

question

English, 04.07.2019 12:00

Along with your claim, your thesis statement needs to include how many main points?...

question

Mathematics, 04.07.2019 12:00

1. what is the solution to the inequality? - 2/3(2x - 1/2) ≤ 1/5 x-1 express your answer in interval notation....

question

Mathematics, 04.07.2019 12:00

Atrain traveled 360 miles in 6hours, how many miles per hour did the train travel...

question

English, 04.07.2019 12:00

Who is the person in the allusion “kidd the pirate”?...

More questions: Mathematics Another questions

Questions on the website: 13722363