subject
Mathematics, 16.10.2020 20:01 moore7165

What is 0.345 in standard form

ansver
Answers: 3
Show answers

Another question on Mathematics

question
Mathematics, 21.06.2019 12:40
Which graph represents 2x-5y< 15
Answers: 1
Answer
question
Mathematics, 21.06.2019 20:00
Hell . what are the solutions to `10x^2 - 38x - 8 = 0`? is this when i find the factors and use the numbers within the factors to determine the zeros? i hope that made sense lol
Answers: 2
Answer
question
Mathematics, 21.06.2019 21:30
Janice determined there were 10 possible outcomes when tossing two coins and spinning a spinner numbered 1 through 6. what is the correct number? what might have been janice's error?
Answers: 3
Answer
question
Mathematics, 21.06.2019 23:30
Maren is buying carpet for her rectangular living room. the room is 4.8 yards wide and 5.2 yards long. how much carpet does she need to buy? enter your answer as a decimal in the box. yd2
Answers: 1
Answer
You know the right answer?
What is 0.345 in standard form...
Questions
question
Business, 15.04.2020 03:53
Consider the equation %ΔM + %ΔV ≈ %ΔP + %ΔY. If the velocity of money does not change (%ΔV = 0), and the change in real GDP exactly keeps pace with th...
question
English, 15.04.2020 03:53
The main idea is usually found after the topic sentence. True False...
question
Mathematics, 15.04.2020 03:53
What is the approximate area of the figure ?...
question
Social Studies, 15.04.2020 03:54
Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...
question
Business, 15.04.2020 03:54
Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...
question
Biology, 15.04.2020 03:54
Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...
question
Physics, 15.04.2020 03:54
The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...
question
Business, 15.04.2020 03:54
Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....
question
Biology, 15.04.2020 03:54
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...
question
Mathematics, 15.04.2020 03:54
A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...
question
Mathematics, 15.04.2020 03:54
1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...
question
Mathematics, 15.04.2020 03:54
Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....
question
Computers and Technology, 15.04.2020 03:54
We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...
question
Physics, 15.04.2020 03:54
A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...
question
Business, 15.04.2020 03:54
One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...
question
Health, 15.04.2020 03:54
Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...
question
Business, 15.04.2020 03:54
A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...
question
Mathematics, 15.04.2020 03:54
Engineers want to design seats in commercial aircraft so that they are wide enough to fit 99 % of all males. (Accommodating 100% of males would requir...
question
Medicine, 15.04.2020 03:54
Tuberculosis is a serious bacteria infection. If you become infected with tuberculosis you will?...
question
History, 15.04.2020 03:54
The image on the right shows Mary Vecchio reacting to a student who had been shot by antiwar protestors antiwar officials the...
More questions: Mathematics Another questions
Questions on the website: 13722363
See results (0)