subject

Mathematics, 04.04.2020 16:49 maribel5979

What is the complementary DNA strand for the DNA strand
AATTGGCCATGCATGATTACGA

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 13:10

Determine whether triangle tjd is congruent to triangle sek givent (-4,-2), j (0,5), d (1,-1), s (-1,3), e (3,10), k (4,4)and explain the reason. select one: a. yes, by sssb. no, by aasc. no, by asad. yes, by sas

Answers: 1

question

Mathematics, 21.06.2019 18:30

Two cyclists 84 miles apart start riding toward each other at the same. one cycles 2 times as fast as the other. if they meet 4 hours later, what is the speed (in mi/h) of the faster cyclist?

Answers: 1

question

Mathematics, 21.06.2019 20:30

Explain how you divide powers with like bases.discuss why the bases have to be the same.how are these rules similar to the rules for multiplying powers with like bases.

Answers: 1

question

Mathematics, 21.06.2019 21:30

Find the missing dimension extra points

Answers: 2

You know the right answer?

What is the complementary DNA strand for the DNA strand
AATTGGCCATGCATGATTACGA...

Questions

question

History, 22.04.2020 02:47

Explain 5 ways there was disparity between white and minority populations at this time...

question

Physics, 22.04.2020 02:47

The hydraulic cylinder imparts a constant upward velocity vA = 0.23 m/s to corner A of the rectangular container during an interval of its motion. For...

question

Biology, 22.04.2020 02:47

Morbidity rate is an important parameter used by epidemiologists to measure disease. If there are 10 new cases of measles per 10,000 individuals in a...

question

Law, 22.04.2020 02:47

Wind-Block Inc. manufactures equipment required for building wind turbines. It isthe monopoly holder in the industry, which gives it the inherent powe...

question

Business, 22.04.2020 02:47

Rather than worry about introducing a new sports recovery product, Gabriel told his staff that they should repackage the existing products and promote...

question

English, 22.04.2020 02:47

Development of a mature identity involves an internalized and evolving story of the self that reconstructs the past and anticipates the future in such...

question

English, 22.04.2020 02:47

A child sustains a fall at home and is brought to the hospital emergency department by the child's mother. After a radiographic examination, the child...

question

Biology, 22.04.2020 02:47

The thermoacidophile Sulfolobus acidocaldarius lacks peptidoglycan, but still possesses a cell wall. Which of the following statements is likely to be...

question

Chemistry, 22.04.2020 02:47

The relationship between hemoglobin and oxygen is dependent on the affinity between the two molecules, which describes the degree to which hemoglobin...

question

Engineering, 22.04.2020 02:47

A piston-cylinder assembly contains water vapor, initially at 10 bar and 360 deg C. The water undergoes a process where pv=constant until it reaches a...

question

Biology, 22.04.2020 02:47

What is another term for the responding variable?...

question

Physics, 22.04.2020 02:47

Your friend thinks that the escape speed should be greater for more massive objects than for less massive objects. Provide an argument for his opinion...

question

Mathematics, 22.04.2020 02:47

Woof Chow Dog Food Company believes that it has a market share of 25 percent. It surveys n = 100 dog owners and ask whether or not Woof Chow is their...

question

Mathematics, 22.04.2020 02:47

Express the complex number in trigonometric form. -3 + 3 square root of three...

question

Social Studies, 22.04.2020 02:47

When grading student papers, Professor Arthur uses a grading rubric that specifies performance standards for grammar, organization, references, and cr...

question

Mathematics, 22.04.2020 02:47

For the next three questions, use the following information to determine your answers: A survey was sent out to re-evalute the proportion of people wh...

question

Computers and Technology, 22.04.2020 02:47

) Suppose algorithm A takes 10 seconds to handle a data set of 1000 records. Suppose the algorithm A is of complexity O(n2). Answer the following: (i)...

question

Physics, 22.04.2020 02:47

A technician is checking refrigerant system pressures. Both high- and low-side service ports are located on the A/C compressor. When the compressor is...

question

Business, 22.04.2020 02:47

Which of the following statements is correct? Multiple Choice Built-in stability only partially offsets fluctuations in economic activity. Built-in st...

question

Business, 22.04.2020 02:47

: a) depreciation for equipment purchased on January 1, 20X2 - 120,000 b) rent expense - 200,000 c) bad debt expense - 80,000 Below are the exchange r...

More questions: Mathematics Another questions

Questions on the website: 13722363