subject

Mathematics, 01.04.2020 03:29 keisha71

The measure of BAC is 240. what is the ratio of the measure of the major arc to the measure of the minor arc

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 15:30

For what is the measure of the angle at the top of the shed? a. multiplication of areas b. squaring of areas c. addition of areas d. division of areas

Answers: 1

question

Mathematics, 21.06.2019 17:00

Why did the ice arena get so hot after the big game (this is math related google it to find the paper

Answers: 2

question

Mathematics, 21.06.2019 19:30

Julian wrote the following numeric pattern on the board3,10,17,24,31,38.what numbers of julian's pattern are compound numbers.

Answers: 2

question

Mathematics, 21.06.2019 19:30

1. are the corresponding angles congruent 2. find the ratios of the corresponding sides 3. is triangle jkl congruent to triangle rst? if so what is the scale factor

Answers: 1

You know the right answer?

The measure of BAC is 240. what is the ratio of the measure of the major arc to the measure of the m...

Questions

question

Mathematics, 19.10.2020 08:01

At an archeological site, the remains of two ancient step pyramids are congruent. If ABCD~=EFGH, find AD (Diagrams are not to scale) AD=...

question

Mathematics, 19.10.2020 08:01

ABCD is a parallelogram such that ∠A=(3x - 10)°, ∠C= (x + 80)°and ∠D = (y + 25)°. Find the values of x and y. ILL MARK ANYONE WHO GIVES...

question

Advanced Placement (AP), 19.10.2020 08:01

In the book behind closed doors. How does Jack plan to explain Millie and Grace's absence once he begins his torture?...

question

Mathematics, 19.10.2020 08:01

The sum of two numbers is seven. The sum of the squares of the two numbers is twenty-nine. Find the two numbers....

question

Mathematics, 19.10.2020 08:01

Please I need some answers ...

question

Mathematics, 19.10.2020 08:01

5) Which angle forms a linear pair with 7)Which angle forms a pair of vertical angles with

question

Arts, 19.10.2020 08:01

Where did the woman go if they were overwhelmed in Pompey’s Theatre?...

question

Mathematics, 19.10.2020 08:01

Write an equation of the parabola that passes throigh the points (-2,7), (1,10), and (2,27)...

question

Mathematics, 19.10.2020 08:01

Solve for x, picture below 30-60-90 triangle ...

question

Biology, 19.10.2020 08:01

On a corpse, there are beetles and mites, but no flies, ants, or larvae. Which is the correct postmortem interval? 8 days 4 days 1...

question

Mathematics, 19.10.2020 08:01

Yahtzee is a classic dice game played with 5 dice. Each player's turn consists of rolling the dice up to 3 times in hope of making 1 of 13 categorie...

question

History, 19.10.2020 08:01

Question 3: What was the importance of international economics (trade and commerce) on the emergence of the colonies in the Americas. Be sure to expla...

question

Physics, 19.10.2020 08:01

Give two important reasons to do a rough sketch of the crime scene?...

question

Mathematics, 19.10.2020 08:01

14) Which of the following correctly shows the markings for a perpendicular bisector?

question

Biology, 19.10.2020 08:01

Hep pl In an mRNA sequence in the following order:CGUAUGGGCUUACUAGUCUAACA: What is the first anticodon to enter the P position?B. W...

question

Physics, 19.10.2020 09:01

Are the most efficient detector of light...

question

Mathematics, 19.10.2020 09:01

4+7x=-10+5x please answer...

question

Mathematics, 19.10.2020 09:01

PLEASE HELP ASAP!Reasoning The numbers 1.333... and 1.444... are both rational numbers. Which of the following is an irrational number that is betwee...

question

Mathematics, 19.10.2020 09:01

Write an expression to represent the area of the rectangle below in simplest form.

question

Mathematics, 19.10.2020 09:01

Just complete h, i, j, k, L pleaseee I'll brainlist (don't forget working out)

More questions: Mathematics Another questions

Questions on the website: 13722359