subject

History, 19.09.2021 21:40 macylen3900

Which phrase best completes the diagram? Purposes of governments Protecting citizens Resolving conflicts ? O A. Giving all people jobs O B. Planting crops C. Invading countries O D. Providing services

ansver

Answers: 1

Show answers

Another question on History

question

History, 21.06.2019 14:30

1: how did the rise of rulers with total power in europe and asia lead to world war 2?

Answers: 1

question

History, 21.06.2019 18:30

What event had weakened florida’s economy immediately before the start of the great depression? a) the freezing of orange trees b) the end of florida’s land boom c) the start of another world war d) the building of florida’s railroads

Answers: 2

question

History, 22.06.2019 09:30

Which statements describe thomas jefferson? select the three correct answers . a.first secretary of state b.second president of the united states. c.considered a liberal. d.father of the democratic-republican party remember choose 3 that are correct! thx

Answers: 3

question

History, 22.06.2019 10:00

Ireally have to get this done today and i'd appreciate any i could get, !

Answers: 3

You know the right answer?

Which phrase best completes the diagram? Purposes of governments Protecting citizens Resolving confl...

Questions

question

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

question

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...

question

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...

question

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

question

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

question

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

question

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

question

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

question

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...

question

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

question

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...

question

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...

question

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...

question

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...

question

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...

question

Mathematics, 15.04.2020 03:54

Engineers want to design seats in commercial aircraft so that they are wide enough to fit 99 % of all males. (Accommodating 100% of males would requir...

question

Medicine, 15.04.2020 03:54

Tuberculosis is a serious bacteria infection. If you become infected with tuberculosis you will?...

question

History, 15.04.2020 03:54

The image on the right shows Mary Vecchio reacting to a student who had been shot by antiwar protestors antiwar officials the...

question

Advanced Placement (AP), 15.04.2020 03:54

Imagine imagining things worthless to spend money on bro Free Points lol...

question

English, 15.04.2020 03:54

Read the following sentences. "Mom, may I please—" "One second, Mia. I just need to finish typing this letter." The purpose of the dash in...

More questions: History Another questions

Questions on the website: 13722360