subject
Health, 18.11.2019 02:31 alaina05

Explain the effects of exercises on your health-related components of fitness (flexibility, muscular strength and endurance, cardiovascular, and body composition) since beginning this course.

ansver
Answers: 3
Show answers

Another question on Health

question
Health, 22.06.2019 09:00
Acoastal community is drafting a plan in case of a hurricane. which action is an appropriate element for an effective plan? 1.) creating a map of areas that are not affected by storm surge 2.) plotting the location of all fire hydrants along major travel routes 3.) relocating any individuals who might be affected by the disaster 4.) identifying multiple evacuation routes for each area of the community
Answers: 3
Answer
question
Health, 22.06.2019 13:30
Describe two habits that can you move toward achieving your goals.
Answers: 1
Answer
question
Health, 23.06.2019 09:30
Which of the following statements is a blaming message ? a. “i think we made a mistake.” b. “you’ve messed up everything! ” c. “we can’t mess this up.” d. “i apologize for the error.”
Answers: 2
Answer
question
Health, 23.06.2019 12:20
Which of these is a sexual stereotype?
Answers: 2
Answer
You know the right answer?
Explain the effects of exercises on your health-related components of fitness (flexibility, muscular...
Questions
question
Mathematics, 15.04.2020 03:53
A scatterplot is used to display data where x is the amount of time, in minutes, one member can tolerate the heat in a sauna, and y is the temperature...
question
Mathematics, 15.04.2020 03:53
QUESTION 1 To what was Douglass referring when he wrote 'From that moment, I understood the pathway from slavery to freedom. It was just what I...
question
Business, 15.04.2020 03:53
A manufacturer of hospital supplies has a uniform annual demand for 320,000 boxes of bandages. It costs $10 to store one box of bandages for one year...
question
Business, 15.04.2020 03:53
Purchase-Related Transactions The Stationery Company purchased merchandise on account from a supplier for $14,500, terms 2/10, n/30. The Stationery Co...
question
Engineering, 15.04.2020 03:53
A household refrigerator that has a power input of 450 W and a COP of 2.5 is to cool five large watermelons, 10 kg each, to 8°C. If the watermelons ar...
question
Mathematics, 15.04.2020 03:53
In 5-card poker, played with standard 52-card deck, 2,598,960 difficult hands are possible. If there are 624 different ways a "four-of-a-kind" can be...
question
Business, 15.04.2020 03:53
Hofstede studied how culture influences consumer behavior. When a Japanese company decides that it will be willing to lose money for twenty years in a...
question
Physics, 15.04.2020 03:53
Even though Alice visits the wishing well frequently and always tosses in a coin for good luck, none of her wishes have come true. As a result, she de...
question
Business, 15.04.2020 03:53
Identify the items as consumer programs or consumer information sources local chambers of commerce consumer reports state cons...
question
English, 15.04.2020 03:53
Kite Runner Quiz Chapters 1-5 1. The novel begins with a flashback. What do you think is its purpose? What do you learn about the narrator? 2. Who is...
question
Computers and Technology, 15.04.2020 03:53
Which of the following is not a true statement? a. Data flow diagrams and flowcharts are difficult to prepare and revise using software packages. b. D...
question
Business, 15.04.2020 03:53
Consider the equation %ΔM + %ΔV ≈ %ΔP + %ΔY. If the velocity of money does not change (%ΔV = 0), and the change in real GDP exactly keeps pace with th...
question
English, 15.04.2020 03:53
The main idea is usually found after the topic sentence. True False...
question
Mathematics, 15.04.2020 03:53
What is the approximate area of the figure ?...
question
Social Studies, 15.04.2020 03:54
Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...
question
Business, 15.04.2020 03:54
Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...
question
Biology, 15.04.2020 03:54
Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...
question
Physics, 15.04.2020 03:54
The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...
question
Business, 15.04.2020 03:54
Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....
question
Biology, 15.04.2020 03:54
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...
More questions: Health Another questions
Questions on the website: 13722363
See results (0)